Photographic Inspirations from Expressionist Movements

If asked to describe my work in photography, I would reply Conceptual, Abstract, Expressionism and so I was sad to have let pass the Tate Exhibition “Expressionists: Kandinsky, Munter and The Blue Rider”, 25 April – 20 October 2024.

There are some videos posted on YouTube that folks have create of the Exhibition, such as an introductory talk and a perception of what the exhibition was like.

A couple of points I was fascinated by were the revisit to the idea of art created from personal experience and of the spiritual, both items I can identify with from a Final Major Project – Past Present 2020. The other was the discontinuance of the Blue Rider movement due to the start of the Great War that led me to discover how Expressionism did continue on, albeit in other movements.

I was pleased to discover or reaffirm the following taken verbatim and for reference here the ideas from a brief analysis:

Key Continuations of Expressionism:

1. Die Neue Sachlichkeit (The New Objectivity) – 1920s

After the war, Expressionism split into different strands, one of which was Neue Sachlichkeit, a movement driven by disillusionment with idealism and a focus on realism and social critique.

Key Artists: Otto Dix, George Grosz, Max Beckmann.

Their work retained the expressive distortion and intensity of early Expressionism but was now focused on grim reality, the trauma of war, and social injustice rather than the mystical themes of Der Blaue Reiter.

2. The Bauhaus & Expressionist Influence

Wassily Kandinsky, one of the key members of the Blue Rider, continued his exploration of spiritual abstraction at the Bauhaus (founded in 1919 by Walter Gropius).

While the Bauhaus is more associated with modernist design and functionalism, Kandinsky, Paul Klee, and others maintained the Expressionist idea of inner necessity and spiritual abstraction.

Key Themes: Pure abstraction, colour symbolism, and form as a means of spiritual expression.

3. Scandinavian & Nordic Expressionism

Edvard Munch, a precursor to Expressionism, continued painting through the 1920s and 1930s, exploring psychological states and existential themes.

Nordic Expressionists such as Emil Nolde (despite being linked to Nazi Germany) maintained the tradition of intense colour and personal vision.

4. Abstract Expressionism (1940s–50s)

The spiritual aspirations of Expressionism found a new life in Abstract Expressionism in the United States, particularly in the work of:

Jackson Pollock, who explored automatism and the subconscious.

Mark Rothko, who aimed for spiritual transcendence through colour fields.

Willem de Kooning, who distorted figures in a way reminiscent of German Expressionists.

Many German Expressionist artists fled to the U.S., influencing the development of modernist abstraction, particularly through exile artists like Josef Albers and Hans Hofmann.

5. Postwar German Expressionism (Neo-Expressionism, 1970s–80s)

The 1970s and 1980s saw a revival of Expressionist concerns with personal experience, intense colour, and distortion in Neo-Expressionism.

Artists like Anselm Kiefer, Georg Baselitz, and Jörg Immendorff drew upon the themes of war, memory, and existential struggle, echoing the psychological depth of earlier Expressionism.

Summary

While the Blue Rider movement ended with World War I, the core Expressionist idea of conveying subjective experience, emotion, and the spiritual in art continued in many different forms:

Social critique in Neue Sachlichkeit.

Spiritual abstraction in Bauhaus and Abstract Expressionism.

Psychological depth in postwar and Neo-Expressionist art.

For my part I take from this the named artists as a source of further research, which for me will bias towards photographic art.

Already on my radar are Rothko and Albers so some new names to follow up on Abstract Expressionism. Also, the mention of themes of war, memory, and existential struggle are prescient. In particular expansion of the existential aspect of former struggles and our gains since may be a extension of my work.

I’m glad to have come back to my Blog if only to store this information so it is not lost to me. The fire is re-lighted.

Log in to WordPress to make edits as follows

Well, I’ve been away from the blog for long enough to fall foul of the introduction of 2 factor authentication, meaning I couldn’t get in to my site to make changes.

I found two approaches, the first is a way (now the only way?) of making edits on a smartphone directly within the JetPack app. What has JetPack got to do with editing WordPress I hear myself ask? Although Jetpack is the new preferred method, its introduction is far from intuitive, given the lack of WordPress branding, unless of course you simply get used to it by using it all the time.

The second way of logging in is to open the WordPress.com website and when prompted to enter a code. Forget about using the text me the code option as nothing happens. Instead go to smartphone and open the Google Authenticator. On opening the app, it was ready with the code, which was then typed into the WordPress requested field on desktop. I was in at last.

I clearly must have set up these two methods and with so much time away and therefore lack of practice, I’d clean forgotten these new methods. I was clearly still recalling the original method of logging into the WordPress.com website. A case of old dog, new tricks.

Generic Photography versus Conceptual Art Photography

To me the course “Digital Photography: Discover your Genre and Develop your Style” is at variance with Conceptual Art Photography.

Research

At Annex A, the proposed method of developing photographic practice for a conceptual art photographer seems comprehensive, covering a range of photography genres. However, there are several areas where it could potentially be improved and refined to better align with the needs of a conceptual art photographer.

  1. Conceptual Focus: The focus on ‘Things’, ‘People and events’, and ‘Environment’ is too broad and could be more concept-driven given the audience is conceptual art photographers. It’s worth noting that conceptual art photography isn’t about the subject per se, but about the concept or idea behind the artwork. It could be more beneficial to focus on exploring themes, symbols, narrative structures, and the theoretical underpinnings of conceptual art.
  2. Abstract Elements: The plan seems to lack the mention of abstract or non-literal photographic techniques. For a conceptual photographer, the ability to create and manipulate abstract elements in photos is essential. This can include techniques such as multiple exposures, motion blur, use of lights and shadows, color theory, and digital post-processing techniques.
  3. Critical Theory and Context: It’s crucial to understand the wider context and critical theory that surround conceptual art. For example, the understanding of semiotics, the study of signs and symbols, is paramount in conceptual photography. The plan should include elements of art history, philosophy, and cultural studies to provide a deeper understanding of the context in which the photographer is working.
  4. Storytelling and Concept Development: There seems to be no explicit mention of developing storytelling skills or learning to create and develop concepts. Conceptual photography often has a strong narrative or idea behind it. Developing skills in conceptualizing ideas and turning them into compelling visual narratives should be a part of the plan.
  5. Review and Critique: A key aspect of developing as a photographer is receiving feedback on your work. Incorporating peer reviews, critiques, and discussions can help photographers learn from each other’s strengths and weaknesses.
  6. The Business Side of Photography: The practical business side of photography seems missing. Topics like copyright, marketing, selling art works, or developing a portfolio and online presence would be beneficial for aspiring professional photographers.

To summarise, while the current plan provides a broad base of genres, for a conceptual art photographer it might be more beneficial to focus less on the specifics of each genre and more on developing skills in concept creation, storytelling, abstract elements, critical theory, and professional practices.

As for Critical Theory I expand on this a bit more:

Critical theory in the context of art and photography refers to a range of theoretical and philosophical perspectives that seek to understand, interpret, and critique art and culture. Here are some of the key aspects of critical theory for the conceptual art photographer:

  1. Semiotics: This is the study of signs and symbols and their use or interpretation. In photography, semiotics can be used to analyze and create images that communicate specific ideas or concepts.
  2. Postmodernism: This theory criticizes modernist ideals and encourages questioning of grand narratives and ideologies. It often involves the deconstruction and analysis of images, exploring how they reflect or subvert cultural norms and power structures.
  3. Psychoanalysis: Concepts from psychoanalysis, such as those developed by Sigmund Freud and Jacques Lacan, can be used to explore themes of identity, desire, and the unconscious in art.
  4. Feminist Theory: This theory examines gender inequality and the social and political structures that perpetuate it. In the context of art, it might involve critiquing the male gaze or exploring the representation of women and gender roles.
  5. Marxist Theory: This theory involves the critique of capitalism and the exploration of class structures and struggle. In art, it might involve a critical analysis of the art market or the commodification of art and images.
  6. Post-colonial Theory: This theoretical perspective deals with the effects of colonization on cultures and societies. In art and photography, it might involve exploring themes of identity, race, and power dynamics.
  7. Queer Theory: Queer theory focuses on sexuality, challenging the heteronormative structures of society. In art, this could mean exploring non-normative sexualities and genders, and challenging traditional representations.

Incorporating these theories into the study of photography can provide a deep understanding of how images are created, interpreted, and received. They can offer valuable tools for conceptual art photographers who wish to create thoughtful and challenging work.

General

The Open University (OU) course is similar to and supersedes other online course materials, TZFM200 in particular. The described approach simplifies the topic of genre selection and style development. This presumably allows the photographer who is growing in confidence to connect which you might think is good. However, the 10 weeks is spread over the busy summer holiday period which can be a logistical challenge. But then it is not so easy to complete the course by the time the assessment comes around, That is unless one is super clear about creating a statement of intent (SOI) and following it through while doing a substantial edit that leads to 12 really good photographs that fit the SOI brief.

Annexe A

Here is the marketing information from a new Open University course delivered by FutureLearn in partnership with the RPS:

https://www.futurelearn.com/microcredentials/digital-photography-discover-your-genre?utm_source=Iterable&utm_medium=email&utm_campaign=fl_marketing&utm_term=230627_MIC_TAR_EXTENDED

Digital Photography: Discover your Genre and Develop your Style

Explore different photographic genres, styles, and approaches

Created in collaboration with the UK’s leading photography organisation, the Royal Photographic Society, this microcredential will give you a broad overview of a number of photographic genres and the knowledge, skills, and techniques to create better photographic narratives.

Build your photography skills and learn how to work to a brief

This course will encourage you to explore different areas of photography to help you identify where you want to develop your creative photography skills, confidence, and knowledge.  Some of the subjects covered in this course include:

  • ‘Things’ – including product and food photography
  • ‘People and events’ – exploring portraiture, sports, and photojournalism
  • ‘Environment’ – looking at wildlife, buildings, architecture, and landscapes

You will learn how to work to a brief and how to prepare and take images to create a body of work within these subjects that tell a visually cohesive story. You will discover how your approach to taking or displaying an image can affect how it is understood and explore the conventions related to particular genres.

Develop a photography project that realises its intent

Building on your basic photography skills, you’ll start to understand what it means to be an intentional photographer as well as how to think about and write a Statement of Intent that explains the purpose and objective of your portfolio.

This course is delivered on the FutureLearn platform and you will also access Behance, a third-party image sharing site by creating a free account. This site is used to share your images with co-learners and develop your photographic eye by learning and practising how to give feedback on each other’s images.

Learn from experts, with The Open University and the Royal Photographic Society 

Created by The Open University in collaboration with the Royal Photographic Society, you’ll learn from current thinkers and experimenters who specialise in particular genres and approaches to photography.

Throughout the course you’ll take part in weekly activities to support and consolidate your learning. You will share ideas and experiences with co-learners, building skills, confidence and knowledge from peer to peer feedback and weekly challenges to experiment and explore your new creative approaches, techniques and practices, and the concept behind your intent.

At the end of the course, you’ll submit an assessment which is marked and graded by academic experts from The Open University. The assessment requires you to submit a set of 12 images and a statement of intent. You will also be required to show how you have worked with others in the group, evidencing feedback on other students’ work.

The FutureLearn social learning experience is designed to encourage learners to interact and benefit from a stimulating learning community. On-course mentors encourage collaboration between learners and offer guidance. Feedback on images throughout the course will come from your co-learners. After you’ve completed the course you’ll receive detailed, personal feedback on your assessment from academic and subject matter experts.

This course replaces Digital Photography: Creating a Professional Portfolio (OU course code: TZFM200.) It is a completely new course, however the assessment is similar in shape and level. If you have any questions, please contact us prior to enrolling.

What skills will you learn?

  • Genre specific field skills
  • Critical reflection 
  • Visual awareness
  • Researching and working to a brief
  • Giving constructive feedback

The Academic Blog

“Michael Turner CRJ,” is a platform where I share my journey and experiences in the world of photography and visual arts. I discuss various topics related to photography, including different techniques, reflections on my work, and reviews of other photographers’ work.

In my blog, you’ll find different sections:

  1. MA in Photography: Here, I share my experiences as I pursue a Master of Arts degree in Photography. I reflect on my coursework, discuss my assignments, and share my thoughts on the overall learning experience.
  2. Photographers: In this section, I review and discuss the work of various photographers. I reflect on the techniques they use and how their work influences my own photography.
  3. Techniques: This is where I discuss various photographic techniques. I share my experiences in trying out these techniques and reflect on their effectiveness.
  4. Reflections: Here, I reflect on my own work. I discuss my thought process in creating my photographs, the challenges I face, and the lessons I learn.
  5. Research & Reading: In this section, I discuss various research materials and readings related to photography. I reflect on books, articles, and other resources that I find helpful in my study of photography.

I regularly update my blog with new posts and encourage interaction through comments.

Unleashing the Power of a 400 Megapixel Mirrorless Camera: Exploring Print Sizes and Image Enhancement Techniques

The available mirrorless camera has a maximum resolution of 8192 x 5464 pixels, which translates to approximately 29 x 19 inches at 300 pixels per inch (ppi) when printed.

In 400 megapixel mode, the camera captures a series of images and then combines them into a single high-resolution image with a resolution of approximately 16,384 x 10,922 pixels.

Assuming a print resolution of 300 ppi, the largest physical print size possible from the camera in 400 megapixel mode would be approximately 55 x 36 inches. However, it’s important to note that the exact print size achievable may depend on factors such as the printing technology and viewing distance, and the final image may need to be downscaled or cropped for optimal quality.

Using Topaz Gigapixel AI the image height can be extended x6 to 330 inches which is now too tall for exhibiting. At a height of 1.85 metre / 55 inches the multiplier doesn’t need to be x6, Nearer 1.3 (1.324) would suffice especially when the print wouldn’t go to floor level.

Update on making immersive test prints on an Epson 180 / 360 ppi A2+ printer:

Assuming a print resolution of 300 ppi, the largest physical print size possible from a camera in 400 megapixel mode would be approximately 55 x 36 inches. However, to refine the size for an Epson printer that operates at 360 ppi, we need to adjust the calculations. If you’d like to print at a larger size without noticeable loss of quality, 180 ppi can be used.

First, let’s calculate the maximum print dimensions at 360 ppi: To calculate the dimensions, we need to know the pixel dimensions of the 400-megapixel image. Assuming a 4:3 aspect ratio, a 400-megapixel image would have dimensions of approximately 23200 x 17400 pixels.

At 360 ppi: Width: 23200 pixels / 360 ppi = 64.44 inches Height: 17400 pixels / 360 ppi = 48.33 inches

So, at 360 ppi, the largest print size would be approximately 64.44 x 48.33 inches.

Now, let’s calculate the maximum print dimensions at 180 ppi: Width: 23200 pixels / 180 ppi = 128.89 inches Height: 17400 pixels / 180 ppi = 96.67 inches

At 180 ppi, the largest print size would be approximately 128.89 x 96.67 inches.

However, the available printer can use roll paper but has a maximum width of 17 inches. To print the maximum size, you would need to print the image in strips that could be joined together side by side to achieve the maximum resulting print width required.

At 360 ppi, you would need to divide the width (64.44 inches) by the maximum printer width (17 inches): 64.44 inches / 17 inches = 3.79 strips (round up to 4 strips)

At 180 ppi, you would need to divide the width (128.89 inches) by the maximum printer width (17 inches): 128.89 inches / 17 inches = 7.58 strips (round up to 8 strips)

So, you could print the image in 4 strips at 360 ppi or 8 strips at 180 ppi and then join them together side by side to achieve the maximum resulting print width required.

Challenging Photographic Image Size: Revisiting the Potential for Large-Scale Prints

The world of photography has come a long way since the inception of my photographic practice. From the traditional use of film to the advent of digital photography and mirrorless bodies, the technology has advanced by leaps and bounds. One such advancement that may revolutionise my stills based photography is the ability to capture high-resolution images. However, this was not the case in my practice until a recent development in mirrorless DSLR in body stabilisation IBIS introduced the capture of 400Mp images.

In the past, photographic image size was limited, and my preference was for low-resolution capture to enable smooth operation of my creative post processing workflow.

This was primarily due to the economic limitations of technology at the time. Affordable pro DSLR cameras were not capable of capturing high-resolution images. In the latest firmware release the mirrorless DSLR can. The cost of processing and printing high-resolution images was prohibitively expensive. The latter may still be the case except with a resolved body of work there is less risk of repeated iterations of the expensive process.

Despite the former limitations, I was able to create abstract works of art up to A4 size. I relied on my creativity and the ability to manipulate the image in post-processing to produce the results. In fact, like some other photographers we preferred the low-resolution capture as it allowed us to produce a more dream-like, painterly effect due to exploiting software mechanisms e.g. smoothing.

However, with the advent of digital technology, the limitations of photographic image size have been largely eliminated. High-resolution images, such as the 400Mp technology, became available in a recent firmware exploitation of IBIS control as mentioned.

When combined with tools such as Topaz Gigapixel, which uses AI to increase the resolution of images up to six times, the possibilities for creating large-scale prints should now be possible within my practice

This development has challenged an earlier decision to limit photographic image size. For example, in the past, A4 prints were considered large enough for most purposes. However, now the potential for creating extremely large prints is possible, with the ability to create prints the size of a house door. I will proceed to confirm the technical details allow this or at least find out the new maximum limits.

Some of my earlier work incorporated hand-drawn vector graphics which would scale if I reintroduced these experiments which I really enjoyed.

The decision to revisit the intention from 2019 to produce work on the scale of Marc Rothko’s as immersive “Art as an Experience” now seems practical with the techniques available here. The potential for creating large-scale prints that allow the viewer to stand close and experience the work on a visceral level is exciting. This is particularly true for photographic works that capture the beauty of the natural world of the human healing experience.

In conclusion, the advancement in photographic technology has challenged the traditional limitations of photographic image size. The potential for creating large-scale prints that allow the viewer to experience the work on a visceral level is exciting. The decision to revisit the original intention to produce work on the scale of Marc Rothko is a logical one, as it allows the creation of immersive art that can be experienced on a grand scale.

A revisit to colour at large scale: 2:1 prints around 72’ tall through newly available high resolution techniques

Renewed Design Interest in Building out My Gallery Space

Hello there! I am excited to share with you that I am restarting work on the 3D model of my studio space for my Exhibition. As you may know, I created the 3D model as part of my Masters Final Major Project back in 2020. Since then, I have not had the chance to work on it, and my SketchUp skills have become quite rusty. Therefore, my main objective in revisiting the 3D model is to reacquaint myself with the SketchUp tool and improve my skills.

One of the tasks I need to do is to add my exhibition photographs to the pre-existing virtual display/exhibition frames. This will enable me to showcase my work and share it with others virtually. However, I need to find some learning resources to help me get back up to speed with SketchUp.

To this end, I have scoured the internet and found a range of useful resources, from YouTube videos to SketchUp courses. I thought I would share these resources with you so that you too can benefit from them.

Firstly, I found a series of SketchUp tutorials on YouTube at this link that are perfect for beginners. These tutorials cover everything from the basics of navigation to more advanced features such as 3D modeling and rendering. The tutorials are easy to follow, and the presenter explains things in a clear and concise manner.

Secondly, I discovered a range of SketchUp courses:

SketchUp Campus

SketchUp Fundamentals with set of Exercise files

These courses cover a range of topics, from the basics of SketchUp to more advanced features such as using plugins and extensions. What I like about these courses is that they are self-paced, so you can learn at your own speed.

Lastly, I came across the SketchUp website itself, which has a range of learning resources available. They offer a range of tutorials, videos, and webinars, covering everything from the basics to more advanced topics.

I am excited to dive back into SketchUp and improve my 3D modeling skills. I hope this post has been helpful in pointing you towards some useful resources for learning SketchUp. Whether you are a beginner or an experienced user, there is always something new to learn. Happy modelling!

Hauntology

I extended research in a number of directions to include a self made music piece following a visit to the University of Westminster in December 2019 and attendance at basic instruction on creating music with GarageBand in the nearby Apple Store. This composition was in a Hauntology style and recently in expression has evolved. I also created a video using iMovie that by now is due an update with a refresh of the images used, Parked still are a number of my processed ghost images that have never been shown outside of my course. All of these mediums: sound, video and visual extend somewhat eerily into the realm of Hauntology.

Of Phenomenology and Hauntology

Hauntology is a range of ideas referring to the return or persistence of elements from the social or cultural past, as in the manner of a ghost. The term is a neologism first introduced by French philosopher Jacques Derrida in his 1993 book Specters of Marx. It has since been invoked in fields such as visual arts, philosophy, electronic music, anthropology, politics, fiction, and literary criticism.

“Hauntology” originates from Derrida’s discussion of Karl Marx in Spectres of Marx, specifically Marx’s proclamation that “a spectre is haunting Europe—the spectre of communism” in The Communist Manifesto. Derrida calls on Shakespeare’s Hamlet, particularly a phrase spoken by the titular character: “the time is out of joint”. The word functions as a deliberate near-homophone to “ontology” in Derrida’s native French.

Derrida argues that Marx’s ideas are still relevant today, even though he died in 1883. He writes that Marx’s ideas “haunt” us, in the sense that they are always present, even if we are not always aware of them. Derrida also argues that Marx’s ideas are not simply a matter of the past, but that they have the potential to shape the future.

The concept of hauntology has been used to explore a wide range of issues, including the relationship between the past and the present, the nature of memory, and the possibility of social change. It has also been used to analyze a variety of cultural phenomena, such as the rise of nostalgia, the persistence of colonialism, and the return of fascism.

Hauntology is a complex and challenging concept, but it is also a powerful one. It can help us to understand the past, the present, and the future in new and unexpected ways.

Ginko Walk and Haiku Verse

Brick Lane to Weavers

During an RPS London exhibition at the Espacio Gallery on 23 April 2022, a group of us met up to go on a Ginko Walk with leader Stewart Wall

Project Ginko and Haiku Visual Language

Project Ginko is a photography led research project by Stewart Wall that involves photo-walking in nature observing things, where nature can mean any landscape the photo-walker chooses. The photo-walker uses photography to record the observations and then uses the photography to inspire free-flow writing of haiku verse, that in turn provides an opportunity to think more about the meaning of the image, although haiku is not intended to describe the image.

Haiku originated in Japan as an opening part of a larger poem called renga, which is a term used for collaborative poetry, linked in succession by multiple poets. Project Ginko is about all the individual projects that it inspires, that together make up one mass observation of contemporary life and how humans use space and place to experience life itself. Stewart was inspired to initiate the project when he read a Phaidon 55 book about a Japanese photographer called Shomei Tomatsu, whose photography was described as haiku. This led to Stewart researching the wider concept and meaning of haiku, asking how photography can be referred to as haiku*. You will notice there are few capitals, commas and full stops used, which is part of the haiku tradition, although I am still reading more about those aspects. The design of our project Ginko books is inspired by the Phaidon 55 books.

* As for Stewart’s research question about how photography can be referred to as haiku, here are a few ideas:

  • Use simple, clear visual language.
  • Focus on a single moment or scene.
  • Use natural elements to create a sense of place.
  • Use light and shadow to create mood and atmosphere.
  • Leave some things to the imagination.

In summary, visual haiku is a type of photography that captures a moment in time in a simple and evocative way. It is a great way to express your creativity and to share your vision of the world with others.

During the day in question, I discovered that taking a slow walk presented me with numerous opportunities to reflect on my framing, relook at the subject and reframe. This resulted in two images which when combined during post processing create a narrative, a story of how this was processed in the author’s mind.

I wrote some Haiku verse to accompany the unconventional composite images.

Inspiration was drawn from French post-structuralist ideas, particularly those put forward by Jacques Derrida, such as deconstruction and phantasmagoria.

I am extending my existing photographic practice strand based on deconstructionism and phantasmagoria by working in slow time and making a second exposure that opens up the subject into overlapped composites with jagged frame with an inherent narrative. This new approach allows me to explore the relationship between reality and illusion, and to create images that are both visually arresting and thought-provoking.

In my previous work, I have used deconstructionism (language, meaning and truth; fluidity and instability of meaning) and now introduce deconstructivism (impression of fragmentation, absence of obvious harmony, continuity or symmetry) to challenge the traditional notion of the photograph as a window onto the world. I have toned this down and move away from emphasis on conceptual methods with experimental post processing cropping, image stretching and collage and adapt it here to create images that are more true to representational even if fragmented and unstable. These new images call into question the idea that photographs can provide a truthful representation of reality.

My earlier work, represented surreal landscapes and branched into ghost images and phantasmagoria. Phantasmagoria is a technique that uses light and shadow to create illusions. I still use this technique here to create images that are both real and unreal, both familiar and strange. These images evoke a sense of unease and mystery, and they invite the viewer to question our perceptions of reality.

The jagged frame that I use in my new work is also significant. The jagged frame creates a sense of tension and instability, and it reinforces the idea that the images are not to be taken at face value. The jagged frame also serves as a reminder that the images are created by the photographer, and that they are not simply a reflection of reality.

I believe that my new approach to photography has the potential to create powerful and thought-provoking images. I am excited to continue exploring this new direction in my work, and I look forward to sharing my new images with the

Another Perspective on Layering

Chris Coekin and Noel Nasr conducted a funded project recreating the visual journey of Bob and Anne who visited Lebanon in 1973 taking photographs with a Viewmaster 3D camera which these photographers recreated with two identical medium format film cameras. The distance is always other as a book is limited edition supplied in a cardboard box and includes a viewer with a carousel of the original images. These photographers took two 2D photos and scanned them together as a 2D photo showing the shift.

The 3D element is deemed gimmicky. The point is about the shift.

Instagram @chris.coekin @noelnasr

Reference

Tofeili, F., Coekin, C., Nasr, N., & Abedini, R. 2018. The Distance is Always Other. Publisher Dongola Press

https://www.noelnasr.com/5428758-the-distance-is-always-other

Reference: Deconstructionism versus Deconstructivism

Blog Refresh Planning

Blog Maintenance 2022-05-01

The repair process has successfully addressed the issue of page jitter on this blog, which was caused by a problematic plugin. This jitter had made the blog unreadable for visitors, but has now been resolved.

The addition of block and page templates through a WordPress plug-in, Extendify has given the blog a refreshed appearance, which is perfect timing as new material is being added and earlier posts are being edited.

New work

for 2022

Abstract Photography

Abstract photography is a genre of photography that focuses on the visual elements of a photograph rather than the subject matter. Abstract photographers often use techniques such as unusual angles, close-ups, and selective focus to create images that are visually striking and thought-provoking.

Some of the most famous abstract photographers include:

  • Albert Dros is a Dutch photographer who specializes in abstract landscapes. His work often features dramatic skies, clouds, and water. He has published several books of his work, including “The Art of Abstract Landscape Photography” and “The Abstract Landscape.”
  • Michel Kenna is an American photographer who is known for his black-and-white landscapes. His work is often characterized by its soft focus and gentle light. He has published several books of his work, including “The River of Dreams” and “The Seasons.”
  • William Eggleston is an American photographer who is known for his color photography. His work often features everyday objects and scenes, but he transforms them into something extraordinary through his use of color and composition. He has published several books of his work, including “William Eggleston’s Guide” and “The Democratic Forest.”
  • Aaron Siskind was an American photographer who is known for his abstract photographs of urban landscapes. His work is often characterized by its use of lines, shapes, and textures. He has published several books of his work, including “The Shape of Things” and “A Sense of Abstraction.”
  • Minor White was an American photographer and educator who was a major figure in the development of abstract photography. His work is often characterized by its use of light and shadow. He has published several books of his work, including “Mirrors Messages Manifestations” and “The Eye of Minor White.”
  • Cig Harvey is an American photographer who is known for her intimate and poetic photographs of women. Her work often features the female form in nature. She has published several books of her work, including “The Kissing Hand” and “The Skin Between.”
  • Edward Weston was an American photographer who is considered one of the pioneers of modern photography. His work is often characterized by its use of sharp focus and dramatic lighting. He has published several books of his work, including “California and the West” and “My Camera and I.”
  • Eric Meola is an American photographer who is known for his dramatic and powerful photographs of nature and the environment. His work often features close-ups of plants and animals. He has published several books of his work, including “The Wild Within” and “The Living Planet.”
  • Jocelyn Lee is a British photographer who is known for her abstract photographs of the human body. Her work is often characterized by its use of color, texture, and movement. She has published several books of her work, including “The Body Unbound” and “The Skin Speaks.”
  • Man Ray was an American photographer, painter, sculptor, filmmaker, printmaker, and inventor who was a major figure in the Dada and Surrealist movements. His work is often characterized by its use of humor, irony, and sexuality. He has published several books of his work, including “Man Ray Photographs” and “Self Portrait.”
  • Thomas Ruff is a German photographer who is known for his large-format color photographs of everyday objects and scenes. His work is often characterized by its use of repetition, abstraction, and scale. He has published several books of his work, including “The New Portraits” and “Nude.”
  • Wolfgang Tillmans is a German photographer who is known for his experimental and provocative work. His work often features everyday objects and scenes, but he transforms them into something extraordinary through his use of color, composition, and light. He has published several books of his work, including “All the World’s Futures” and “Lights.”
  • Valerie Belin is a French photographer who is known for her large-format black-and-white photographs of people and animals. Her work is often characterized by its use of harsh lighting, strong contrasts, and dramatic compositions. She has published several books of her work, including “The Human Zoo” and “The Animal Kingdom.”
  • Daido Moriyama is a Japanese photographer who is known for his gritty and realistic photographs of urban landscapes. His work is often characterized by its use of grain, blur, and overexposure. He has published several books of his work, including “Japan” and “Sayonara Photography.”
  • Charlotte Cotton is a British curator, writer, and photographer who is known for her work on the history and theory of photography. She has published several books on photography, including “The Photograph as Contemporary Art” and “The Photograph: A Strange Confined Space.”

Introduction to Photographic Histories 29/6/2020 to 27/7/2020

I took the Introduction to Photographic Histories course, which was run by the Photographers Gallery from June 29, 2020 to July 27, 2020. The course was held over 5 Monday evenings, and it covered a wide range of topics related to the history of photography.

Here is a brief overview of each week’s topics:

  • Week 1: Origin stories of photography

This week explored the origins of photography, from the early experiments of Joseph Nicéphore Niépce and Louis Daguerre to the development of the first commercial cameras.

  • Week 2: Blurred lines, clear visions: Movements of 20thC photography and their legacies

This week looked at the major movements in 20th century photography, including pictorialism, modernism, and surrealism.

  • Week 3: Portraiture and Identity

This week explored the use of photography to represent identity, both individual and collective.

  • Week 4: Beyond Evidence: Documentary photography

This week examined the role of photography in documenting the world around us, both in terms of news and social issues.

  • Week 5: Expanded photographic practices

This week looked at the ways in which photography has been expanded and redefined in recent years, through the use of digital technology and new forms of expression.

Source 2020 Graduate Show

Source provides wider industry exposure of graduate work. My Falmouth University MA Photography project ”Past-Present a mythology of time” is being submitted.

My submission is made in the STAGED/CONSTRUCTED category.

Commemorative work Past Present ends a century of silence held in sadness for ancestors who were repeatedly wounded in battle, and were never to return home from war. In this work, present day images of healing are transformed into visualisations of place. Human connection is amplified as memory is created from a biology shared. As art inspired by cutting edge science, work has been made for individuals bound by the mother line gene. Bonds that were missing, now begin to form. Pictures shown are a selection from an artist’s book, that also includes poetry and prose with these and vernacular images from a family’s past. The book was originally created as part of a Falmouth Flexible MA Photography programme.

The digital version of the artist’s book is located at https://issuu.com/turnerphotoart/docs/past-present_a_mythology_of_time_a4_book_200428

Eight images submitted.

Reviewed:

Congratulations on your submission to the SOURCE Graduate Show! I’m sure your work will be well-received by the judges.

I took a look at the digital version of your artist’s book, and I was really impressed by the work. The photographs are beautiful and thought-provoking, and the poetry and prose add a layer of depth and meaning to the work. I especially enjoyed the way you used the family’s vernacular images to create a sense of place and history.

I think your work is a powerful and moving tribute to your ancestors. It is a reminder of the sacrifices that they made, and it is a celebration of the human spirit. I hope that your work will be seen by many people, and that it will inspire others to learn more about the history of war and the power of healing.

I wish you all the best in the SOURCE Graduate Show!

Landings 2020 Metamorphosis

Landings 2020 Metamorphosis is an online photography exhibition that celebrates the work of 63 photographers from around the world. The exhibition was curated by ThePadilla, a photography platform based in London. The theme of the exhibition is “metamorphosis,” which is explored through the lens of photography.

Your work, which can be found under your name Michael Turner, is a series of antique monochrome photographs of landscapes. The photographs are all taken from a high vantage point, and they offer a bird’s-eye view of the landscape. The photographs are all very abstract, and they seem to suggest a sense of transformation or change.

The opening party for the exhibition was held on the evening of Monday, July 27, 2020. The party was live-streamed on Instagram, and it featured interviews with the participating photographers.

Unfortunately I was engaged with The Photographers Gallery in a mock judging of this years Deutsche Börse Photography Foundation Prize 2020.

The 2020 Deutsche Börse Photography Foundation Prize shortlist was:

  • Mohamed Bourouissa
  • Anton Kusters
  • Mark Neville
  • Clare Strand

The winner of the prize was Mohamed Bourouissa. Bourouissa’s work explores themes of migration, identity, and social justice. He is known for his large-scale installations and photographs that often feature found objects and materials. His work has been exhibited in major museums and galleries around the world.

The Deutsche Börse Photography Foundation Prize is an annual award given to a living photographer who has made a significant contribution to the medium. The prize is worth £30,000 and is accompanied by a solo exhibition at The Photographers’ Gallery in London.

Mohamed Bourouissa, Anton Kusters, Mark Neville, and Clare Strand are all contemporary photographers known for their unique approaches to visual storytelling. Here is a brief introduction to each of them:

  1. Mohamed Bourouissa (b. 1978) – Born in Algeria and raised in France, Bourouissa is a contemporary photographer and filmmaker known for his work exploring social issues and the urban environment. His photography often focuses on marginalized communities, capturing their everyday lives and struggles. Bourouissa’s work has been exhibited internationally, including at the Centre Pompidou in Paris, the Stedelijk Museum in Amsterdam, and the Venice Biennale.
  2. Anton Kusters (b. 1974) – A Belgian photographer, Kusters is best known for his work documenting the Yakuza, the Japanese crime syndicate, in an intimate and immersive project titled “Odo Yakuza Tokyo.” The project spanned over two years, allowing him unprecedented access to this secretive world. In addition to the Yakuza project, Kusters has worked on other documentary projects, exploring themes of identity, memory, and loss.
  3. Mark Neville (b. 1966) – A British artist and photographer, Neville focuses on socially engaged photography that tackles political and social issues. His work often engages with communities and is presented in a variety of formats, such as books, exhibitions, and films. One of his well-known projects is “Deeds Not Words,” which documents the lives of people affected by environmental pollution in the UK.
  4. Clare Strand (b. 1973) – A British photographer, Strand is known for her conceptual and experimental approach to photography. She often explores themes of communication, technology, and the relationship between photography and other visual arts. Strand’s work has been exhibited in numerous institutions and galleries, including the Tate Modern in London, the Museum of Modern Art in New York, and the Victoria and Albert Museum in London.

Post MA

I am pleased to announce that I have been awarded a Master of Arts Photography with Merit from Falmouth University. I joined the course in 2018 and have now completed all of the modules. I thank everyone who contributed to my learning experience and provided critique for my work.

My work is abstract and surreal, and I have enjoyed developing my practice. I have published a book of my work and have an exhibition planned, which was placed on hold due to the COVID-19 pandemic.

I have also taken some short courses in genetics to consolidate and extend my research. I am interested in human biology and mitochondria, and I am now learning more about evolutionary biology. I am also gaining access to databases of DNA data, including my own genome, with a view to creating images related to cutting-edge science.

In summary, I am excited about my future in photography and science. I am grateful for the support of my colleagues and mentors, and I look forward to continuing my research and creative work.

PHO705: MA Photography Award

I’m pleased today 1 June 2020 to record my having been awarded the Falmouth University degree Master of Arts Photography with Merit.

I joined the Positions and Practice Module run by the Course Leader on 4 June 2018 and now 2 years later I’ve satisfactorily completed all of the modules and have finished the course.

I thank everyone for contributing to the learning experience and for providing critique for what became an unusual abstract surreal practice which I have thoroughly enjoyed developing.

In the second block of the Final Major Project, I took my work public as a book and have an exhibition pending release from lockdown hopefully later in 2020.

As I closed in on hand in I began a number of short courses to consolidate and extend the research done during the MA Photography course. Hand in took priority, and afterward I took a few weeks rest.

I’ve since returned to these genetics courses. My “research interest” was in human biology and in particular the power cells or mitochondria. I’ve now spread the net wider to learn more of evolutionary biology while gaining access to databases of DNA data including my own genome with a view to creating images related to cutting edge science.

PHO705: Post FMP Activity

The purpose of these Post FMP Photography blog posts is to do with keeping up the momentum.

Actions

Some items needed packing away.

Privacy

I am concerned about privacy, especially when photographing wounds or minor trauma. I have taken steps to protect the privacy of my subjects, including using a photo vault to secure access to my work. This way, there is no possibility of accidentally showcasing the raw work, for example, if showcasing other work.

I believe that it is important to respect the privacy of my subjects, especially when photographing sensitive subjects such as wounds or minor trauma. I have taken steps to protect the privacy of my subjects, and I encourage other photographers to do the same.

FMP Peer to Peer Meetings

During the COVID-19 lockdown, I and another post-grad, Vincent, rounded up a group of photographers who were interested in meeting regularly. We called this group the Cross FMP Group.

The photographers in the group were all very creative and talented, and we were all eager to stay connected and continue learning during the lockdown. We met regularly to share our work, provide feedback, and discuss photography.

The group was a great source of support and inspiration for me, and I am grateful to Vincent for starting it. I am also grateful to all of the photographers who participated in the group. We were able to grow and sustain the group because we all had a common goal: to remain connected and continue creating during a difficult time.

I am proud of what we accomplished as a group, and I am excited to see what the future holds for all of us.

A New Job

I am disappointed that I was not able to take on proofreader or magazine layout roles, but I understand that the chairman’s spouse has more experience in the former.. I am also disappointed that the Amersham Studios closed, but I understand that the pandemic and the cost of living made it difficult for the business to stay afloat. I am grateful for the opportunity to have volunteered at the studios, and I look forward to returning to volunteering when I have more time.

Ideas

Some things are at the idea stage.

Instagram Story

I’ll post a story on Instagram. This will require learning some skills in Adobe AfterEffects. I planned to sign up on a course but my choice was popular and oversubscribed. You have to ask why do a story? The answer is in parts:

  • close off the build-up of publicity that had led up to the postponed exhibition. That’s just for completeness.
  • announce my impending freedom to reconnect with the photographic communities I was so immersed in until starting the MA studies. I’d rather be confident in knowing my outcome before this step.
  • the post lockdown promotion of the postponed exhibition

Photo Art Website

This is work in progress and will require finishing.

Ongoing Blog

Blogging has become a way of life this past several years and for me has been a successful development as a great deal of experience was gained.

As long as there is something to say this blog should continue. I feel this would be better than letting the newfound ability wither with time.

Remaking and making books

I am planning to take my FMP Book to a more commercial level and distributing it. I also plan to expand the book practice to other topics. In the queue, I have:

  • The Cosh Brothers – the story:. Illustrate, print and make.
  • Ed Ruscha challenge – Book 1 Padlocks. Re-print and hand bind
  • Ed Ruscha challenge – Book 2 Chains. Print and hand bind
  • Ed Ruscha challenge – Book 3 Phone Entry Systems Print and hand bind

I have finally learned a critical amount of the capabilities of Adobe InDesign. This is my third involvement since September 2018. I would like to keep up this skill. With more practice, there is the possibility to expand into an Adobe qualification.

I am excited about this new project and I am confident that I can produce high-quality books that will be enjoyed by readers. I am also looking forward to learning more about Adobe InDesign and expanding my skills in this area.

PHO705: Incorrect Print Result – initially colour off and green cast. Subsequently a ‘silent’ swap to the restricted paper choice with the AirPrint driver

Silent software updates led to issues with my Epson P800 Printer, prompting me to initiate a recovery plan and conduct a thorough analysis of the print process. Despite setbacks, including a technical issue and the COVID-19 lockdown forcing the cancellation of my exhibition, I remained adaptable and managed to complete my book within a shorter time frame.

This is a recurring problem caused when software updates. I’ve added an Annexe below to contain more detailed information relating to how I’ve setup for print.

User Resolution

1 Connect the Mac computer and printer by direct wire

2 Reinstate the link to Epson paper profiles by reinstalling the driver software. This triggers the choice of Epson driver over Apple Airprint for you to select

3 Select Printer Manages Colors

By filming the required page-turning video and creating a 3D model of the exhibition space, I demonstrated resilience in overcoming challenges. My experience highlighted the importance of being prepared for the unexpected and staying flexible when faced with unforeseen events.

However, the problem with ICC paper profile selection on the Epson P800 Printer persisted in the years that followed, as automatic software updates caused the printer to lose the link to the folder containing Epson ICC paper profiles. The default connection became AirPrint, which only recognized generic profiles supplied by Apple, rather than specific Epson paper types.

Advice

It sounds like you had a lot of challenges to overcome in order to complete your FMP. I’m glad that you were able to persevere and produce a high-quality piece of work.

I understand your frustration with the Epson P800 printer. It sounds like the software updates are causing problems with the ICC paper profiles. I’ve done some research, and it seems like this is a known issue with the printer.

There are a few things you can do to try to fix the problem. First, you can try uninstalling the printer driver and then reinstalling it. You can also try disabling the automatic software updates for the printer.

If those steps don’t work, you may need to contact Epson support for help. They may be able to provide you with a newer version of the printer driver that fixes the problem.

I hope this helps!

References in case required:

https://www.redrivercatalog.com/infocenter/tips/how-to-fix-missing-paper-media-type-selection-OSX.html

https://community.adobe.com/t5/color-management/printer-profiles-missing-for-epson-sc-p800/m-p/10870908#M3033

Annexe A – Print setup additional information.

Where are the ICC profiles located for my printer on my Mac?

• Do the following to locate the files:

1. Open your hard drive, then select Library > Printers > EPSON > InkjetPrinter2 > ICCProfiles.

2. Press and hold the Control key on your keyboard while you click the profile package in the ICCProfiles folder. In the pop-up menu that appears, select Show Package Contents.

3. Select Contents > Resources.

https://epson.com/faq/SPT_SCP9000SE~faq-00009ed-shared?faq_cat=faq-topFaqs#:~:text=Do%20the%20following%20to%20locate,%3E%20EPSON%20%3E%20InkjetPrinter2%20%3E%20ICCProfiles.

ColorSync

The profiles can also be found using the Colosync app.

Profile Naming Variations

Note when viewing the print paper profiles in a) the package (see above Where are the ICC profiles located) the file names are used. B) in ColorSync a description is used (contains some of the file name information but missing the printer ID SC-P800 and c) in the photo app (e.g. Photoshop) Print – media selection, there is another very similar description. Simply note the identification is the same but different depending on where you view the paper ICC.

Printer icons

On the computer, print icons existed for three devices: one for a Canon portable printer and two for the Epson P800. One is for the AirPrint driver (do not use) which is live as wifi is available, the other Epson P800 icon is for the direct cable connection. If the printer cable becomes disconnected that print option is offline.

Check:

1. A print cable is connected between computer and Epson P800

2. Ensure the direct connection icon is set as default.

This is to avoid a silent swap to the AirPrint.

PHO705: Week 24 Reflection

Done. The work has been done. Everything was handed in well in advance or in advance.

It proved important to leave enough time for checking as the inevitable was ready to happen – the screen freeze and colour printing going all wrong with an unexpectedly deep dive into ColorSync print technology.

Restart work on the Exhibition items put on ice

The video refresh, the music, the exhibition in a box were all in work but lost out as publication turned to book when the exhibition was postponed. Now there is time to prepare for a new date.

I’ll continue to check this blog for any mistakes. I know there a few.

Reflection

At the current point, much has been taken from the course. Starting with a new passion for bookbinding. Things there are going wild with three more hand bindings lined up.

Practice in using media tools with a vengeance was a highlight too.

Fulfilling the objective of making a portfolio of publishable work was the aim at the outset and how that has been helped along.

Making pictures as Art based on cutting edge Science ArtSci became a revelation in the area of genetics This genre is ripe for new picture making.

PHO705: Assignment Final Major Project (PDF)

Submit Assignment here

Depending on the nature of your practice, your resolved project may take one of a variety of forms, however, and it will be an original, authored piece of creative practice, of a publishable standard. It will have been developed over the FMP module and will extend from or otherwise draw upon work created throughout the course.

The FMP submission will evidence and document your critically informed project that is resolved to a professional and publishable standard.

The form that your project takes will depend on the nature of your practice and should reflect your creative intent. It should be resolved as appropriate to the work itself and with considered purpose. As the consideration of audiences and markets are key concerns throughout the course, you are strongly encouraged to present it to an appropriate public audience.

This may include, but not be limited to:

  • An installation
  • Solo or group exhibition;
  • Editorial feature;
  • Book;
  • Online project;
  • Workshop;
  • Performance, screening or talk;
  • Symposium or conference presentation.

These artefacts and/or activities should be clearly evidenced in your FMP submission.

The document should include:

  • A concise description of the work,
  • The final images of the project or an edit thereof,
  • Documentation of the publication (e.g. installation shots, tear sheets),
  • Critical feedback or analysis from other professionals (if applicable),
  • URLs to relevant video or other supporting material.

You may wish to remind yourself on guidance for documenting your FMP submission.

Format

It should be:

  • A colour, page-numbered, PDF document
  • Text should be 1.5 line spaced and use a 12 point, sans serif font
  • Fully Harvard referenced throughout, where applicable
  • All images should be fully titled and referenced
  • No more than 15MB

Assessment

The Final Major Project accounts for 60% of the final grade for the FMP module. It will be assessed on the following Learning Outcomes:

LO1: Technical and Visual Skills

Demonstrate an awareness of a range of photographic and image-making processes, and display accomplishment of photographic skills relevant to your practice specialism.

LO2: Visual Communication and Decision-Making

Exercise discernment in the making, resolution and presentation of practical work, and an ability to communicate ideas through creative visual strategies.

LO3     Critical Contextualization of Practice

Apply a critical awareness of the diversity of contemporary photographic practice to the development of your own work, and inform your practice through historical, philosophical, ethical and economic contextualization.

PHO705: Week 4 Assignment Final Project Proposal

This was a week for handing in the FMP Project Proposal

Proposal PDF

The next step is to book a 121 meeting with my Supervisor.

Bibliography

Howard Rachel (2018) Repetition is truth via Dolorosa. Edited by A. C. Beard Jason. London: Other Criteria Books. Available at: newportstreetgallery.com.

PHO705: Week 23 Reflection

Week 23 has been about letting the work fall into place given that all the research and the practicalities of exhibition and book had been readied. Now for the resolved body of work.

Critical Review of Practice CRoP Update

The Critical Review of Practice had input from a group of reviewers during the week. Review has been especially valuable given the abstract surreal nature of the pictures. The work does communicate! This accords with feedback from the August 2019 practice exhibition although the work did move on.

The CRoP was submitted before the Easter break and one more review was received later in the week which will be incorporated and the CRoP will be resubmitted with a tighter ending.

Picture Edit and Book Draft

The picture edit took place during this week. Having tightened this down considerably from the original set of 50 – 80 images I then got productive and created a whole other set of family archive / DNA edits.

So far I’ve resisted adding these as sometimes the temptation is to over embellish at which point it can get out of control, especially if a distraction to the work.

This page-turning video was made. I recycled prints made for an external review which here are made into a brochure.

Narrative Lines

There was at least 6 months of research into themes and creating a visual narrative. I had believed I’d need to place an abstract surreal on recto pages to keep them from clashing, but have a text to picture or cloud DNA composite on the verso to pick out the narrative with clouds of text or alternatively, text to picture generative art.

What happened during the edit was that picture matching fell into place and some well matched pairs resulted (my view and a reviewer view).

This eliminates the need for the verso narrative with a cloud of text or text to picture plate. The cloud method developed now unused is quite focussed on theme through word selection. Thinking about DNA bases annotated as ACGT, then by selecting 100 words I can make narratives out of the English language set of around 1100 words where those four letters appear e.g. ’photographic’ (phoToGrAphiC). Still singing the praise of the method inspired by Recombinant rhymes and DNA Art (RRDA), it provides the photographer with exceptional flexibility in overlay as narrative creation which is important to my choice of conceptual approach in the abstract surreal, if it helps the viewer along. There is a visual challenge of overlaying the text with an appropriate photograph that blends sympathetically with the work. There is a variation where a poem or song lyric can be overlaid on an image as text to picture (rather than as emphasised words in a cloud). The outcome of RRDA subtlety leads the narrative line as the other of the 300 words are still shown. As the viewers eye scans the composite they may trigger not just on the emphasised words but others they see. By leaving this open to the viewer they do in effect choose their own interpretation as they do normally but each time they return to the verso and recto they can gain more as the method keeps on giving.

So why so much thought on something that didn’t get used in Past-Present in the Artist’s book or the extended Exhibition with multiple themes in separate spaces?

It’s just that the method is contemporary and works in its own right. It is combinatorial in word selection (100C3 for the current approach for the mathematicians amongst us). Out of Past-Present has been created a whole area of endeavour and here the idea is shared with anyone interested in such ways of visual language creation. I have time to consider a side exhibition of RRDA pictures as a standalone group of theme common that contrasts with the figurative forms from my main exhibition of abstract surreal pictures.

I now think these verso images deserve a separate portfolio. An early example of the method was to use poem or song lyrics (in text to picture generative art) overlaid on the source picture. There is no creative limit. The fact I like it so much as photographer was the trap if I shovelled in too much research spoiling the simpler visual narrative that was used in the end. Post-FMP submission I’m going to return to RRDA.

The rules that developed for this included a) not crowding out the central pictures, only allowing then to punctuate transitions in picture style.

The text method is flexible and effective but for ‘Past-Present a mythology of time’, these verso images graphic content I decided would push against the grain of abstract surreal pictures.

What I’m focussed on is creating a resolved body of work.

The textual method formed a valuable part of my research and acted as insurance if there was viewer disconnect. The abstract surreal images paired up well visually and this reduced the need for additional support. That turned out well.

The resolved body of work approach led me to rationalise the use of ghost pictures. Place is represented as ghost landscapes and are core to the work. The people ghosts and the cellular division theme together are dropped as themes in the book. Ghost have a place in the exhibition as a side exhibition.

A-V production that included ghosts was researched as part of the FMP PDF. Again it is interesting and possibly quite dramatic but is not needed for now.

Poems and Interview

A version of the book has been created as a PDF and ISSUU publication in order to gather in review comments.

I had to resolve different views about supporting pictures with text. For now I’m happy to have:

  • a short section of prose relevant to the theme
  • a poem about place and archive picture
  • an interview
  • the core pictures
  • repeated as miniatures with caption and print details as an index

There are improvements and review inputs to deal with before imposing and collating the pages into the book.

The book will be case bound, with a block comprising kettle stitched signatures. This type of hand-bound book was created in an earlier module. The current book will be the fourth to be hand made.

It is expected that an even tighter edit will arise from this for the Final Major Project PDF submission.

Final Major Project FMP PDF document

This is the last major assignment to be handed in and is worth 60 points. It is due before 1May. I have this in synopsis form ready to pull together.

Inputs to this will include the picture edit developed out of both the exhibition and the book.

Media will be created to demonstrate the materiality of the book.

In lieu of the exhibition, the 3D model created, for now, will be set-up with the selected pictures and screen captures will be taken from a 3D model I’ve made to synthesize the studio/gallery space.

Audio

I’ve been keen to address a requirement to present in different forms. Recently I gained insight. I’d seen the exhibition and book as equivalent when in practice they have very different sets of demands even though the pictures overlap.

I want to avoid forcing the narrative with audio in the FMP PDF. When the pictorial element starts to resolve why then distract the viewer?

When it dawned how different the exhibition and book are then the problems resolved. I enjoyed the learning and it was simply a journey I had to make.

Although the audio has been dropped it may well find its place in the exhibition later on where the physical space benefits from creating a conducive atmosphere with linked but contrasting works. The thing is our aim is a professional body of work of high quality. Adding media, audio in this case, that produces a Ronald Dhal-esq scary story feel which he did aimed at the child audience then it clearly goes wrong. The work would start to emphasise the child in me and while the creative child never went away the style goes against the level of publication required for this FMP.

I did additional external studies on sound recording and on podcasting and set about practising technique within my practice. It proved to be quite sustaining and a) took my mind away from being too focussed on my practice. This led to a breakthrough with selecting the edit and b) settled my thoughts during the lockdown.

My work was not halted because I’d chosen at the start of the degree second module to work on a subject that was sustainable. However, there are many distractions to photography while comprehending the impact of the lockdown.

External courses, applicable to my practice proved a welcome distraction. There has been knowledge and skill development that I’m glad to have had even if audio is dropped.

External Practitioner Reviews

The reviewers have adapted to circumstance with the COVID-19 move across from physical exhibition to making of a book. I shouldn’t complain that the project changed emphasis as in a last year critique I not only began to be recognised as a maker of books but was strongly advised to make a book. Why didn’t I listen? It would have been too easy to follow the guidance but once more I had a journey of learning to embark upon. I came into the course with a specialism in books and it would have been my loss to only had done books and not have explored what this course has to offer to practice development.

I met a chosen art photographer reviewer at the exhibition space before lockdown and they kindly went over an extended set of test prints and later the draft portfolio website. I decided to engage early and bring my external reviewers back in towards the end. It is a delicate art interacting like this as it chews up the time, and actually had to disengage for a fortnight to get on. Usually it saves failure and avoids starting all over again.

The practitioner reviewers onboard I’m delighted to say are:

  • a fellowship art photographer
  • a fellowship fine art photographer
  • a fellowship book collector and editor
  • a journal editor and
  • a multi-genre, multi-award winning and twice professional photographer of the year finalist.

 

PHO705: International Women’s Day

How does this day have a bearing on this blog? Simply put it is the link to the motherline theme. Motherline is based on the mother’s DNA. Her mitochondrial DNA in particular provides us with the means of creating life giving energy. The associated stability or unchanging structure within family members allows identification with ancestors. This DNA bridges across time for thousands of years. My project bridges just over a century.

When the current project is complete, attention can be turned to other families, to other past events, to be carried forward for future generations.

PHO705: DNA Art Portraits

With an eye on commercialising art, the following is from AffinityDNA (AffinityDNA, 2020). This blog post demonstrates the contemporary and growing economic aspect of this genre allied to my photography. Perhaps by marketing photography, it could pay for the cost of the studies. Currently, there is communication taking place with another major DNA testing supplier on an introductory and more mundane level perhaps.

DNA Art Portraits

Display your DNA fingerprint as a unique personalised piece of genetic artwork! DNA art portraits from only £179

In terms of context this offering is available amongst other tests:

This demonstrates the contemporary and growing economic aspect of this (my) genre of photography.

Bibliography

AffiinityDNA (2020) Affinity DNA. Available at: https://www.affinitydna.co.uk.

PHO705: Generative Design

The exercise using word clouds worked/is working well according to the intended outcome and as such is being developed into another technological sphere of artsci known as Generative Design (Bohnacker, 2012) and the update (Gross, 2018). We are now at an intersection with computing.

Generative Design: Ghost with Lyrics – Michael Turner

Generative Art practice has a returned and is being made part of my MA Photography. The above image is one of the ghost pictures that arose from healing photography. It uses a graphics or more specifically a font from pixel values technique and is created with the lyrics of Robert Burns song, A Man’s a Man for A’ That. (Burns, 1795).

Bibliography

Bohnacker, H., Gross, B. and Laub, J. (2012) Generative Design Visualise, Program, and Create with Processing. English tr. Edited by C. Lazzeroni. New York: Princeton Architectural Press. Available at: www.papress.com.

Burns, R. (1785) A Man’s A Man For A’ ThatBurns Country. Available at: http://robertburns.org/works/496.shtml.

Fross, B. et al. (2018) Generative Design Visualise, Program and Create with Javascript in P5.js. Edited by C. Lazzerolli. New York: Princeton Architectural Press. Available at: www.papress.com.

PHO705: Effects

This post surprisingly is about layering and effects as it is starting to become late in the day for further development. Finished work will be required imminently.

Follow-on Work from Book Design Meeting

The meeting with book designer Victoria Forrest had taken the direction towards using own genomic data. A 700,000 sample of the human genome from my own test results has been downloaded and secured. It remains to decide how and how far to extend its use and this could be via layering as in three examples created to date.

  • Great grandmother and boy outdoor portrait with glow image overlapped
  • Grandmother posed by rock with glow image and DNA base pair layering
  • A tablet of DNA base pairs overlaid on mono glow image.

Other possibilities are an illustrative option for use for example to add content to a facing page. The theme can either punctuate change or run continuously. This compares with amending each work created to date to incorporate base pairs.

The DNA test data contains autosomal, Y-DNA and mtDNA data. Apparently the test no longer lead to the latter two being made available.

Themes and Use of Effects

Some of the image themes within the overall project lead to the possibility of going to the next level of visual presentation by working with Adobe After Effects. Specifically the Ghost persons themes work well with Spotlight enhancement with motion. Music has also been composed for this. The overall production should be very emotive. However much this is lining up as the next evolution of this work, it kind of was dropped from the project scope for now.

Another thematic element is the use of Effects alongside the inner/outer space visuals or cellular portrayal falling under the heading of Pan Cellular Ex Cellular – all cells are made from cells a reference to the DNA transcription process that enables life and link made to the past.

The cellular theme is ripe for working in Adobe After Effects with Trapcode Particular from Red Giant. Practice in this domain as part of a course or courses completed in advance of the this Falmouth MA Photography course.

For now, this blog post has to be limited to a record of strong intent as expansion into 3D and VFX must not detract from the Assignments. Keep to the plan and the timeline for now.

PHO705: Portable Exhibition

This blog post refers to the idea of taking the work outside of the white cube exhibition space, using facsimile mounted prints in a display box.

It was recommended at the Arles critique last year that a new box is made and while open to the idea, it was decided to investigate. This was done by researching the methods for making a clamshell and flip lid boxes.

Having handmade a box in the past it has been clear how much of a challenge such a simple intention can become. Research has been conducted and shows a range of techniques from simple paper folding through to the use of guillotine and cast iron press.

There are many minor considerations that affect the construction and finish – tiny triangular nicks and unexpected cuts and folds to cover corner spaces and raised section to keep out light and dust. This is quite an enterprise. The tooling is an expensive consideration as is attending a centre such as London Book Arts.

Design: woohoo

Box-making cut details

So what about drawing on the resources of a firm that offers custom made boxes. The factors come into play are cost etc. At a 5,000 piece run the box I’d need would be approximately £1 per box. That’s too many boxes and too high an outlay. At a single box the cost is £50 – it is almost better re-ordering the original DNA test kit.

To show how subtle the flip-top box is to make a PDF design has been attached:

Here is the dummy box using the above plan to work out print constraints, folding, scale, weight, strength and glueing:

PHO705: Group Critique with Module Leader

While the focus of late has been on writing the Critical Review of Practice and on ‘plussing’ the visuals, this post relates to a switch back to the public presentation of the work.

Switching tasks like this may be less efficient than running each task to completion. Professional development of photographic work might call on multiple resources, but here for the MA Photography, the author becomes or has become the sole resource for all of the work.

Collaboration practised as a professional specialism has yet to flow into the making process, so it has become quite a busy time. Considering research turned to image-making only a month ago then a lot of ground has been covered.

The making in the digital darkroom had been akin to the process of creating a painting. Now with the change of methodology and processing, the mental task of visualising and the way time is consumed is closer to photographic sculpture.

A National Portrait Gallery Friday evening drawing session attended last year, was conducted with white pencil on black paper, the process of observation and drawing likened to making sculpture.

Guest Group Critique

In presenting the work it was noted how exciting the development of the project has become and how this easily extends the work beyond the time available to us on this MA Photography course. With practice development, the project is likely to undergo further extension and presentation beyond May 2020. It is very exciting at this stage

A minor comment was the all-important selection of the sans serif Granville light font for use in the book and in the PDFs – the Critical Review of Practice assignment PDF and the book PDF hand-in.

As for the work shown in the critique an original InDesign file was shown having evolved through a one to one session, to the recent book designer session, to the subsequent splitting out of themes into individual files and finally and importantly the addition of more new work.

The project had all along used but now re-presented as having a trace of author’s DNA both as glow and as a graphic sequence.

There was a call to make a model in order to experiment with the layout of images. This would be more of a demonstration or proof exercise. In practice, the author has ongoing access to the studio/exhibition space and so does not require the intermediate step of modelling layouts. In an earlier module, a summer exhibition was held in the same space over a period of 8 days, it will be four days this time.

What is different this time is that access has been gained to the material for constructing exhibition walls from a stand kit. In a one, to one review the author was advised to set this aside, for an unexplained reason. It would be easy advice to take as it makes life easier. It is felt that there was a misunderstanding in communication via the online medium used.

Style, Paper and Framing

The critique was missing much in the way of content as the reviewer needed to see actual prints in front of them. The previous comment was of the look of charcoal on antique paper and was an accurate description of the aesthetic. This is produced both as an adjusted filter and is reproduced as a homemade PS action.

The vignetted borders were said to act against normal framing methods and would require consideration.

A test print was made a little while ago, was on matte paper and set out on the surface of the stock off white mount board used in the Summer exhibition. It all went together well.

There was a call to make a pile of prints as the quality can be more readily viewed and prints allow the order and sequencing to be done. This is an imminent action.

The project is the same one from the start of the course and has recently taken on more of the surreal. As image making began little more than one month ago the thrust has been towards image-making to gain images in sufficient numbers, higher than in the past with quality and with enough spares to support an 18 image exhibition and a book.

Recombinant Rhymes

From recombinant DNA and an artsci process of creating poetry. A decision was made to discover all or as many dictionary words as possible containing base pair letters A, C, G and T together. In order to form two or three-word crossword sections, words were gathered into themes.

There are sufficient range and sophistication of meanings linked to the work as photographic, biological and socio-political. The book would be expanded with facing blank pages set to contain word pairs or triples. No rhymes are intended.

Word Cloud

A simpler approach is the word cloud.

A variation might be to take advantage of scale in order to emphasise selected words. Chosen words correspond with a facing image. The method can be used with my DNA results in two cases; autosomal and mtDNA

Author’s Autosomal DNA and error rate

The Autosomal DNA chromosomes 1-22 are over 99% identical to all other human beings. Above are the mismatch errors in a 600,000 sample from 1.3 trillion base pairs in each DNA strand.

Author’s mtDNA

Mitochondrial DNA (mtDNA) samples for the author scaled by position in the DNA chain. mtDNA exists within the female line, is passed on to offspring female and male offspring and is very very stable. By remaining constant for thousands of years it easily spans the century of ancestors to whom the author identifies with. The Past Present.

Vision 2020

The forthcoming Vision 2020 Symposium and gathering at Falmouth University would have been a great opportunity to unveil the prints. However, the finite risk from the current virus spread and attending an international conference, combined with having caught a virus three times last year, making attendance undesirable.

Campaign

A social media campaign is planned and the first post made on social media using Instagram account foto_graphical. An Easter exhibition has been announced with the title: Past-Present.

Strands are coming together in consistent form.

Practitioner Comment

The advice given to another student was not to go overboard in obtaining practitioner input. A note I’d sent in earlier indicated that one remote critique was booked in, while a contemporary journal editor had responded as a potential attendee. A multi-genre, multi-award-winning professional had also volunteered to comment. Three others are on the back burner, so perhaps this is what was meant as going overboard – two of the three are recognised, art photographers.

PHO705: Book Designer Meeting

We had privileged access to Book Designer Victoria Forrest in a group session. It was useful for me although I’m erring towards a handbound artist book dummy and an exhibition in a box, a repeat of a successful approach from tyhe summer exhibition.

So what was learned:

  • focus on my DNA – I’d downloaded it pivoted it and searched it for transcription errors. It is an interesting error rate. There is some research out there about various diseases and these kinds of errors. My genome is good though as it is 99% shared with other human beings.
  • there’s the work I mentioned before on making visuals from base-pair sequences. As mentioned, there is a legal requirement to look after the genome data for my own protection and that of my offspring. Dry data is a bit too graphic for my liking but can be made to work by skilful handling. I prefer it as a blank verso decoration. Too much of it will be samey or overwhelmingly and potentially take away from the visuals I reckon. 
  • develop an offshoot of an artistic work recombinant rhymes. My take is I’ve gathered all the words containing a letter A, C G and T (base pair letters in DNA) and pick salient words in pairs or threes to describe a context around the project (photography, Great War, etc. but the layout of a crossword puzzle element. 
  • don’t associate with the Berger quote I made for being too inflammatory. Very strange on a Visual Arts course that the subject of reversing Berger’s observation should seem difficult. Surely art should challenge its own foundations. There is nothing illegal that couldn’t be published and after all, why waste a founding pillar and key inspiration to my work?

What else?

  • something on paper gsm was answered 300 gsm is too much and 175gsm is preferred
  • mtDNA is something Victoria is comfortable understanding but leave it out in preference to using own genome work
  • Victoria wanted to know details of my method of making. Seemed a bit cheeky a question in a public forum but unless the person you are working with really knows your work how can it be successful?

That was it in a nutshell, and very good considering five students were on in under two hours. Victoria must have been exhausted by us but thank you.

PHO705: Fonts

Supporting Discussion

The choice of font for FMP submission remains firm as Granville Light. A return to inspect the style after a cooling-off period only confirms this. The use of a Typography Insight App allowed a detailed comparison with a standard sans serif font. The Granville Light style is very much being enjoyed.

Original Post

Time has been spent researching san serif fonts for the FMP assignments and two fonts have shortlisted and have been installed and are being trialled:

  • Granville
  • Auster

Both fonts are very clear and Granville is being preferred on several counts including style which is more apparent on the lower case letters f and t, but also for being from a French designer at a Paris foundry given the project theme of loss in the Great War. The slight dagger-like flourishes in the lowercase letters f and t, also act as a metaphor for me as references to the Dirk and the Sgian Dubh, sheathed pointed daggers carried in Scottish national dress.

I won’t install the Granville font in this blog but provide a PDF example here:

Looking at this example a reservation emerges to do with font width, even as something that makes it more readable. Is it too wide? The answer becomes clear when the font is viewed at the required 1.5 line spacing where indeed it looks fresh and clean as seen in th ePDF above.

PHO705: Creating Draft Critical Review of Practice

Two items have been held up pending 10 weeks of illness then need to create portfolio work.

These are the Video that should have been made over the break and the Critical Review of Practice CRoP.

These have been taken together, but oddly manage to support the work. The following PDF is the mind map. A CRoP is a CRoP but it has to be about something so the overview of working practice and methodology is given as a mind map. The CRoP requirement (or part of) has been mapped onto it and requires further development like issuing a draft. However, there is some referencing to other practitioners still in research. Despite having this for earlier incarnations of the work (in earlier study Modules) the work has progressed on so time for the update.

To an extent I can argue about originality and a need to mask off external influences as the work is quite unique in its standing as a branch of Art based on Science. As blogged previously I’m never surprised anymore to find original thought crop up in other places of which two examples could be cited.

  • Top left hand in the mind map is the Critical Review of Practice from an earlier module assignment.
  • The bottom left hand is a storyboard outline for a useful video resource that is being created. (This proved very helpful to visitors to the summer exhibition).
  • Above this is the connection to the CRoP linked to Ghost Abstract Figurative Themes. While Ghosts per se have been dropped since the review with a book designer, the landscapes remain ghost images.
  • Practice location top right is the piece being updated for this dynamic project. It does need to settle down urgently prints, book, portable exhibition and talk to be worked on.

There is quite a challenge here as none of the work has been subcontracted to printers or anyone else so all of the skills from the photography through to all branches of making have been absorbed and this alongside all of the marked assignment work. For anyone wishing to embark on an MA Photography Course they may wish to consider how much work to outsource to specialists. Personally, outsourcing the Book making to an online offering is not preferred over an artists book dummy and hiring a book designer would lose some of the original intent to someone else’s view of what the market would stand. The work is still too dynamic for this.

Bottom right is the remainder of the CRoP assignment requirement, which pertains to the public showing.

In terms of evidencing the work as mentioned here in an FMP lecture video then on the subject of gaining public feedback, there is a need to reach out to practitioners to elicit attendance or somehow provide comment on the work.

I now have a date of the Easter Weekend for showing the work over four days at Amersham Studios tradesecrets.live Only now can approaches be made by reaching out.

As image-making is fundamental and has been a major focus, work has been flooding forward and is now starting to receive critique (two critiques were missed through technology issues).

There is scope for an earlier pop-up exhibition at the same location. No promises yet. Details will be published and a campaign run via Instagram account foto_graphical and Facebook.

<placeholder> for draft CRoP

PHO705: Similar Works 1

Here is a first new blog post asking, “So where can others’ work be found that has some connection with my practice?”.

Apart from already established and earlier blog references in the PH704 module to Garry Fabian Millar and elsewhere in PH702 and PHO703 to Rachel Howard a revisit is made in advance of the Assignment: Critical Review of Practice.

Here is a single image only comparison from National Geographic (Greshko, 2018):

Photograph Richard Hammond

And my earlier effort in more sombre mood:

DNA Sequence Overlaid with mtDNA Trace
Photograph Michael Turner

I’ll be recreating this. The next version of this work will use my own genome. It was sequenced last year and is currently under my analysis for base-pair errors. This not something to go into too much as it gives insight into the potential for disease a look into the future. As a STEM graduate with expertise in Big Data, it is possible to interpret the science and in particular the data and start to follow scientific papers including on the topic of DNA mismatch (Stavenger, 2010).

It is clear now that the double helix is an idealised form. Due to coding errors the span of the ladder rungs changes while there is asymmetry in the strand thickness and weird folding occurs where molecules other than ACGT bases enter the sequence. There is a knotted effect.

My own connection with the National Geographic story is through working for the corporation that supported the computing for the Out of Africa project. This was an early project that traced the human genome back through eastern and western migration routes to Africa.

As blogged in an earlier post it is the same corporation that provided the infrastructure for the World Community Grid project and the reason for donating computing cycles to this from 2004 on Human Proteome Folding through to current day projects supporting computational biology research into cancer, Aids Zika virus and many more including ground water and other geographic analyses.

Bibliography

Greshko, M. (2018) How We’ve Tackled the Evolving Science of DNANational Geographic.

Stavenger, J. (2010) Mapping of Switch Recombination Junctions, a Tool for Studying DNA Repair Pathways during Immunoglobulin Class SwitchingScienceDirect.

PHO705: Book Design

Having completed most of the research behind the project work is moving forward rapidly as more focus is gained and a single line of visual narrative / aesthetic is settled upon.

The previous work product for a Module Leader one to one session simply gathered together themes that had been evolved. With direction the rate at which outputs are created has increased.

In what follows there is a settling on the aesthetic of “charcoal on antique paper”. Here the aesthetic has extended across a set of evolved themes going into the book review.

After the review, the aesthetic has remained and the direction has been advised on:

  • drop abstracts with added newsreel stills
  • focus on DNA results for self
  • avoid any feminist reference as too hot a topic(?)*

It was decided that a book would be hand bound and advice was obtained on paper weight.

The focus would be as before (at the Summer exhibition), a set of 18 prints on 40×50 mounts, with a miniature exhibition in a box to take beyond the gallery setting. Notes were compared on box production.

From a recent talk by Victoria Forrest it was clear that time would be tight for a full book design and production phase. Whilst it is possible time would be a tight squeeze and the intention was anyhow to hand make the prints, book and boxed prints as artist materials. Past experience of making provided the proving ground. It should be possible to make all of these outputs.

Where time becomes a squeeze is in making supporting materials: contextualising video/moving stills, exhibition guide, online portfolio, marketing leaflets … busy, busy, busy.

Single Pages (scroll to view, hover and click to download)

Spreads (scroll to view, hover and click to download double page spreads).

note:

*“Men act and women appear. Men look at women. Women watch themselves being looked at. This determines not only most relations between men and women but also the relation of women to themselves. The surveyor of woman in herself is male: the surveyed is female. Thus she turns herself into an object of vision: a sight.” (Berger, 1972) page 47.

In my work, men receive their energy-making biology from their mothers. Men are viewed as agents of women. More specifically Men as sons are agent to their mothers.

The stability of the genetic code of energy-giving (mtDNA) is key as is the male being blocked from passing this gene to their offspring. The theme is of a Mother-line.

Bibliography

Berger, J. et al. (1972) Ways of Seeing. re-issued. London, [England]. Available at: http://www.greenpenguin.co.uk.

PHO705: Working up the resolved portfolio

This blog post is a mixture of items from artist research through publication planning through to misleading image editing.

Artist Research

Helen Chadwick

Tony Essler

Exhibition

In the next week, the venue and date will be confirmed with the venue owner. The last exhibition, during the summer, was presented to an audience as a learning exercise in preparation for this FMP module of the MA Photography course.

As a learning thing, it was invaluable on all fronts. It is proposed to repeat this form and improve upon areas identified from advanced ‘marketing’, through to the quality of the edit with improved visual language and narrative.

Rather than stand alone as an unmarked work – course delivery is digital, the exhibition will again avoid being a Vanity project and help build the final PDF edit.

Newspaper|Magazine| Book

Having learned to hand bind and having practised by making two books and an exhibition pamphlet, the principles of making have been acquired and will be used to guide the selection of paper medium rather than allocate time to the unmarked making which cannot be handed in.

So printed artefacts will be designed and made but will use a professional service. A candidate service is currently being looked into.

Exhibition printing and mounting can be kept ‘in-house’. A decision will be made on technique, whether or not to do as in the summer surface mount prints on 40 by 50 board. The quality of the craftsmanship can be elevated to archival print mounting using cutouts and non-destructive taping.

The idea is to act in advance and take advantage of the settled decision to use 4 by 5 print ratio at A4. This means the board can be cut-out in advance. The layout is proven to work with the exhibition physical space and a simplified display method and available studio-style lighting which has been further augmented.

The ‘deal-breaker’ is in the image edit. If necessary, any archive image used that has to be landscape 4 by 5 ratio, will break the exhibition layout not just in terms of conformity but spatially – the exhibition needs to sit well within the identified space.

The conformity can be enforced as long as it makes sense and any ‘vital” image may be re-introduced into the final PDF edit.

The main images were previously described as being in an abstract expressionist style, by creating an emotion or feeling. The project has moved ever closer to the abstract surreal.

The abstract surreal is intended to be themed with archive photographs: originals of the author, family archive or images processed from historical video footage.

Image Editing Update

Having fallen foul of an editing software fault during a previous module (Adobe Lightroom Community, 2018), during the break it became necessary to view edits at a Zoom level of 100%. Work saved radically differed from the same image displayed on-screen during the editing process. What you see is not what you get. Variation from intent does represent a problem.

Some research into the unintended change led to an answer online (Adobe Photoshop Community, 2018).

The explanation is that the processing software avoids computer processing load by interpolating any smaller representation. In the current project, this is typically when the evolving image is fitted to screen – do not rely on what you see on screen unless at 100%. This became apparent in making image comparisons of processing Method A versus Method B following last months (December) Symposium on Imaging Science.

Bibliography

Adobe Photoshop Community (2018) Merge Layers fault. Available at: https://community.adobe.com/t5/photoshop/merge-adjustment-layers/td-p/9842482.

Adobe Lightroom Community (2018) Random red blocks appear on images exported through Lightroom. Available at: https://community.adobe.com/t5/lightroom-classic/seemingly-random-red-blocks-appear-on-images-exported-through-lightroom/m-p/10134977.

Innocence (2020) innocence paris. Available at: https://www.innocence-paris.com/fr/.

PHO705: Digital Darkroom Analysis for Motherline

This post follows on from PHO705: Symposium – Good Picture 2019 “Imaging Revealed”

A detail was examined of the source of image glow in humans

Michael Turner based on UV image by Dr J Crowther

Access to imaging scientists led to emanation being discarded as it is undetectable. Instead, attention is brought to body reflection in the visible light spectrum. The scope was introduced for a secondary effect caused by visible light having triggered bacterial fluorescence.

Further research and reflection have guided change and resulted in the adaption of digital darkroom processing that now uses simpler steps that are easier to manage and more flexible in fine-tuning the healing wound image.

Motherline (mtDNA) and Glow

The ancestral basis of identification between individuals had been established through the Motherline as an image Aura or Emanation.

The method still stands, but as trace rather than direct emanation. Trace is in cellular heat created by mtDNA / ATP processes. This is largely through the increased blood supply at a healing wound. Blood contains levels of mtDNA as do all of the other cells but does not contain nuclear DNA. Direct emanation by humans is a measurable process but it is only detectable using scientific instruments.

We have to discount bacterial fluorescence. Bacteria are necessary to our existence and are present in great numbers alongside our human cells. However, bacteria are not genetically human and so the glow created by bacterial fluorescence cannot be attributed to the ancestral link but to the general population instead. Bacterial glow does not develop the psychological process of identification with ancestors.

Equivalence

Equivalence has been found between:

Process A

In HDR Tone

Compress (gamma) and simplify (slider)

In Levels

Spread and decompress (gamma)

Process B (new)

Simplify (ACR Clarity)

Colour layer | Luminance

In Levels

Spread

Comparison A versus B

The effects are equivalent and the number of steps the same. Method A can lose image data by compressing and decompressing where Method B preserves data. Method B. This gives more scope to subtly enhance the through colour channel (RGB) adjustments.

Conclusion

Processing Method A (HDR Tone) remains valid although there is no direct detection of IR. Method B can be adopted in its place for improved data retention and colour processing. The effect applied can be more readily followed.

Visible light detection is what is present and derives mainly from the blood supply to and around the healing wound and is connected to Motherline mtDNA although. As nuclear DNA is not presented in blood this makes the detection a close.

PHO705: Symposium – Good Picture 2019 “Imaging Revealed”

Note concerning project naming:

The name Motherline is introduced into blog usage below as it is now being adopted. Motherline refers to the photography of healing wounds and the resultant abstract glow images from a digital post method.

Imaging Science

Long-awaited, the Symposium on imaging science took place at the University of Westminster. on Saturday 14 December 2019.

The opportunity existed to be introduced and meet people from the scientific and medical community. A number of those present were from the Kodak or Ilford companies and from the Universities or other professional bodies.

Imaging science participants were generous in giving their time to listen to the Motherline image glow and the post-processing techniques used.

Michael Turner based on UV image by Dr J Crowther
Michael Turner based on UV image by Dr J Crowther

A processed image was created from a UV image portrait captured after the Symposium talk Imaging the Skin – UV, visible light and IR

As preparation for attending the conference, research was conducted into image compression and decompression, as the techniques used in enhancing glow in Motherline photographs.

It became possible to describe to a medical forensic imaging expert the art interpretations of glow in healing and in return obtain vital and conclusive feedback.

A detailed discussion was had on the processing steps for potential infrared detection. The wavelengths for emanations from healing wounds at human body temperature are very long wavelength, well beyond consumer camera detection capability. The conclusion was that there will be no detection of IR emanation.

Where IR is received by a smartphone camera, in the example of the domestic remote control, the wavelength is short enough to be detected depending on the exact optics of a specific camera, lens and bayesian filter.

Blood Supply |Bacterial Fluorescence

However, in the project photography there is a glow present, so where does it come from? A general news article explains (Hrala, 2016).

Foremost is the presence of blood supply around a healing wound.

Potentially there is fluorescence present. Bacteria gather in the region of a healing wound. When excited by an external light source a glow will appear in the visible spectrum. A Japanese research paper examines this in detail (Koboyashi, 2009)

Detection used a cooled CCD in conditions of complete darkness. With a prosumer camera, there is no detection of direct bodily emanation from a healing wound. Rather than emanation, an external light source excites the bacteria and produces fluorescence in the visible light spectrum.

Both of these effects are the likely cause of the glow that appears in the photo project images.

Bibliography

Hrala, J. (2016) You Can’t See It, But Humans Actually Glow With Our Own Form of Bioluminescencescience alert. Available at: https://www.sciencealert.com/you-can-t-see-it-but-humans-actually-glow-in-visible-light.

Koboyashi, M., Daisuke, K. and Okamura, H. (2009) Imaging of Ultraweak Spontaneous Photon Emission from Human Body Displaying Diurnal RhythmPLOS | ONE. Available at: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0006256.

PHO705: Recombinant Rhymes and DNA Art

Project development: rhymes, art and naming of the photo project.

Oxford definition.

This post is an extension of the Recombinant Rhymes and DNA Art (McNamee, 2019) feature in the blog post, PHO705: Research Artsci, Communicating Science Visually, Computational Biology and a new Avant-Garde

The intention is to deliver something art-based (rhyme or graphic text or image titles) over the upcoming period between terms as noted in the Final Proposal. An intention is to experiment to discover if contextualisation and visual language can be built with Recombinant Rhymes or DNA Art.

The idea is to use imagination in selecting words like TELEOLOGICAL that contain DNA base letters ACGT and combine them for effect, perhaps making a video with a reading of a rhyme. Words are intended to be selected for their connection to narratives of the project.

Select from the following ACGT words for some connected meaning:

Examples:

  • Advocating 
  • Fracturing conflagrations
  • Countervailing 
  • Lethargic contagiousness

Interestingly, the validated list contains the terms Abstracting and Photographic.

Project naming

In short, “Motherline” is the name presently chosen. This is less politically charged than the earlier proposed project name “Matriarchy”.

Matriarchy like patriarchy has political overtones, so is not so attuned to the themes of the work.

Motherline is derived here from the post PHO705: Visual Language of DNA Testing and the terms:

  • Family Ancestry (autosomal DNA)
  • Motherline Ancestry (mtDNA)
  • Fatherline Ancestry (Y-DNA)

Bibliography

McNamee, A. (2019) ‘Art of Now Recombinant Rhymes and DNA Art’. A Whistledown production for BBC Radio 4. Available at: https://www.bbc.co.uk/programmes/m0002rkb

PHO705: Group Guest Critique 10 Dec 2019

Theme sets

Themes occur in several sets subdivided. First, are the now consistent outputs of the work, and second, the themes of visual narrative explored and third the set of the subject matter placed before the camera.

In turn, we have:

Out of abstraction, the theme set subdivided into

  • place as landscape/seascape/mountains of heritage and theatre of war;
  • ghosts ever more recurring;
  • depictions of inner/outer space.

Out of the physical and psychoanalytical, the theme sets are around language/communication and intent:

  • science mitochondrial DNA,
  • war,
  • the phenomenological – the weird/eerie/uncanny

Examples of the above can be found in this portfolio:

Portfolio by Michael Turner

There is the theme set of the subject and photography:

  • healing wounds,
  • museum (military and medicine),
  • family archive,
  • video (gaming and broadcast)
  • Generative art.

Examples of some of the above are also in this portfolio.

Portfolio by Michael Turner

In retrospect, this presents the analytical. To think in deconstructivist terms as in Derrida, it would make sense to home in on that which conveys the main feelings. There again Art Science (Artsci) as described by Arthur Millar brings scientific method back into scope. The latter demands more resolution by the artist. Millar points to the history of the avant-garde. The art world and gallery system had rejected impressionism and the likes of Picasso as surrealist. Artists then built alliances later their work being more established it became more widely accepted. Millar might argue the case for art-science as the new avant-garde.

In the case of accepting Millar, then the project proceeds as

Family Constellations

Family Constellations have allowed freedom from entanglement with ancestors and their narratives of loss in a war.

FMP Experimental

View the following as experimental imagery that is work in progress. This is not the end product of publishable standard at this early point.

PHO705: Week 9 Reflection

Bases and Ghost by Michael Turner

Position and Intent

The work is intended to be positioned within Modernism PHO705: Modernism. As abstract it may fit into the Art-Science avant-garde as a branch of Modernism.

The implementation is still open at an early stage. Developments in one direction are towards overlapping archive ancestry images of motherline and mtDNA glow images.

Motherline – Glow by Michael Turner

This is in the direction of Susan Hiller Aura and Falmouth painter Jake Wood Evans. PHO705: Artist Jake Wood Evans

To go ahead, work needs to be resolved. As these firm, vestiges are present in other approaches.

War imagery, either from Museum exhibits or from video archives footage. There is the style of Natalia Goncherova with angels and flying machines compressed into the frame in a very claustrophobic way (as in her lithographs).

Science, as molecular biology, animation and Generative Art.

Further influences begin with Albert Steiglitz and images similar to cloud formations. This is closest to my type of work of any of the above approaches.

by Steiglitz

There persists influence from Picasso, in breaking bounds then Rachel Howard in terms of the hidden brush of gravity abstract style.

Thoughts about Resolution

More wayward approaches need to be set aside where project intent risks being diluted i.e avoid any negative impact.

The strong influence going into the Final Major Project FMP has been to resolve the visual language to make the abstract accessible to the viewer. This was achieved in a summer exhibition although the martial narrative need not be enforced was a consideration.

Having just stated that though, the war theme is necessary otherwise we lose the linkage and orphan the themes of place foreign and theme of ghosts recurrent.

PHO705: Colour

The previous portfolio settled on monochrome and red. It is interesting to re-discover the following quotation from an external to MA course, The Power of Colour. KLC School of Design.

The following colour interpretations are there to be agreed or disagreed with.

“According to Benjamin Whorf’s Linguistic Relativity Hypothesis, the language a person speaks determines how he or she experiences the world. This can affect how someone perceives colour. For example, the Shona language in Zimbabwe does not distinguish between red and orange. There seems to be a pattern, however, in the order in which all languages recognise colours: all languages appear to have a name for black and white, and if a third colour is recognised, that is red, and next comes yellow or green. “

“People who live in sunny climates prefer warm, bright colours, whereas those from places with less sunlight prefer cooler, less saturated colours.”

Quotations from KLC School of Design

There is a useful article What Colors Mean in Other Cultures. This proved useful in the past and so is brought into the scope of this blog post.

Another colour reference is marketing related Colours Across Cultures: Translating Colours in Interactive Marketing Communications

Colour Psychology

Colour Psychology has been extensively written about, and again here in Chivers and Wright. However, there is often a willingness to accept what is prescribed yet the verdict around any rules and interpretations is open in terms of there being no absolute scientific validity.

KLC School of Design

PHO705: Modernism

A re-exploration of the roots of Abstract in Bauhaus, Modernism, Post Modernism and Abstract Expressionism. Here, for now, a start is made.

This blog post serves as a reminder to revisit the developments that led to Abstract Art. This research was started in an earlier module. As there is a link to the chosen abstract genre for the final photo project, there is a reason to extend the reading.

Historic references are recorded here from external to MA studies:

  1. Spotlight on Walter Gropius
  2. The Bauhaus Movement (see timeline at the end of this blog post)
  3. Johannes Itten Biography

Further inquiry begins here with Rothko and Albers.

Mapped History of Abstract Art

(Affron, 2012) Inside front cover

Note: attended Tate Modern Exhibition of Natalia Goncharova during Assessment Period 4.

Marc Rothko

Rothko has had numerous mentions in this blog over the past 18 months:

Josef Albers

Albers work gained mention in an external course on colour but did not gain mention within the scope of this MA blog other than a blog this week PHO705: Artist Jake Wood Evans. To right this here a quotation is taken verbatim from (Affron, 2012) Page 302 as it ties together a number of references:

“Itten’s tenure at the Bauhaus was notoriously marked by the increasing incompatibility between the Expressionist and esoteric impulses of Ittenand his cohort and the functionalist ethos for which the school would become known. That tension is latent in Josef Albers’s Gitterbild (Lattice Picture), also known as Grid Mounted … Working on this piece as a student in the glass workshop of the Bauhaus, Albers cut and arranged squares on manufacturers’ samples of glass within a regular metal lattice. On the one hand, this straightforward grid composition foregrounds the materiality and variety of industrially produced glass, divested of the conventional esoteric connotations of coloured glass panes, for example in church windows. (Albers had created a stained glass window for a church four years earlier, and he would have been thoroughly familiar with the mystical connotations of stained glass). And yet, as light passes through Albers’ grid, Kandinsky’s immaterial fantasy of unbounded colour returns, finding subtle expressions through the chromatic emanation of light.”

(Affron. 2012) Page 302
Gitterbild (Lattice Picture) / Grid Mounted Josef Albers

The above plate is from the book Inventing Abstraction (Affron, 2012)

Alfred Stieglitz

Stieglitz work (Birgus, 2002) Pages 44 and 45 have visual similarities with the earlier portfolio images created for the MA as well as the current crop of images. Interestingly the 4×5 print format is common.

[metaslider id=3845 cssclass=””]

Images – Alfred Stieglitz

Laslo Maholy-Nagy

Having read photographic theory expounded by this writer and artist, and now having viewed a particular image, a chord has been struck. It concerns the appearance of the Christian symbol of the cross as it recurred in earlier work in the build-up to the MA portfolios.

In memory of Sibyl Maholy-Nagy – Laslo Maholy-Nagy

Wassily Kandinsky

Kandinsky is linked in the quotation above and has been previously blogged.

PHO703: Week 1 to 12 Surfaces and Strategies Contextualisation

Bibliography

Affron, M., Bois, Y. and et al (2012) Inventing Abstraction 1910-1925. 3rd 2014. Edited by D. Frankel. New York: Department of Publications Museum of Modern Art. Available at: http://www.thamesandhudson.com.

Birgus, V. et al. (2002) Die Kunst der Abstrakten Fotografie The Art of Abstract Photography. Edited by Jager Gottfried. Stuttgart, Germany: Arnoldsche Art Publishers.

Appendix

PHO705: Artist Jake Wood Evans

Attention was drawn to Irish artist Jake Wood Evans painting style.

Connected here is the use of Turner family archive photographs mixed with abstract art which has been trialled. Also, similar is the work of Susan Hiller – Aura, already referenced in this blog,

Paintings – Jake Wood Evans

There is something similar in intent. The final photo project images almost exclusively in black and white may benefit from hand colourization before mixing with mtDNA abstract art images. A basic sepia colouration might be a start.

What could be quite exciting would be the use of some muted or bold colour theory – this is getting quite exciting. Some practice and reading (Albers, 2013) and (Quiller, 2002), were conducted as part of the project research in an earlier module.

Also attended was a four-week course on The Power of Colour presented by the KLC School of Design. Colour theory also makes a regular appearance in Studio photography workshops at work.

Bibliography

Albers, J. (2013) Interaction of Color. 4th edn. Yale University Press. Available at: yalebooks.com/art.

Quiller, S. (2002) Color Choices Making Color Sense out of Color Theory. New York: Watson-Guptill Publications.

PHO705: Thinking allowed/aloud

As current research continues into Phenomenology and mtDNA, a break is taken to cast ahead to publication. The work has to be taken to the public and is still experimental as shown in PHO705: WEEK 9 REFLECTION. Some of the making stages in the plan will arrive soon enough.

It makes sense to gather some direction even though the desire is there to complete work in progress reading as mentioned in PHO705: WEEK 10 REFLECTION.

Thinking through one idea here has a purpose of creating a Strawman. This will have enough form or structure or clarify the artistic design. This idea is about a book and starts with Ghost images. These creations appear fleetingly and have to be captured before they disappear. There is a need to conquer this and to avoid there being no work of this type to show. Apparitions are always welcome to this work but the nature of creating them is open to the random. A perhaps predictable but nevertheless still surprising element of this randomness occurred during a period of distraction in which Ghost images began to appear in other made work, outside of the main project. Perhaps these intrusions are just another type of Ghost, linked to the main project by occurring during the project timescale.

In the previous module, an attempt was made to help progress by restricting image scope to abstract Landscape. At first, this was a mistaken choice. As with Ghosts, Landscapes are also subject to random process but nevertheless, they regularly feature in the work.

The experience was somewhat worrying as having restricted scope to landscape the theme was worked towards for a solid two weeks and the worst – no Landscape could be made. Letting intuition take over the method of obtaining the desired result was finally fathomed. A way of making at will was settled on which largely depended on recognising the kind of processed starting image that might work. There is an earlier Landscape representation with horizontals and verticals that would have been readily obtained from the start, which may still feature as published work, but what it had led to was a more imaginative scene that required more sophisticated processing more akin to perspective images as compared to earlier flatter images.

All this is taken as a lesson learned around the intuitive making versus something closely allied to a ‘commissioned’ approach.

The Week 9 reflection above turned up a Ghost of the kind sought. But what if that was it? in this case, it might be necessary to showcase the image as a full-page and in a process of categorisation accompany it with earlier ghost images as a plate of smaller inserts.

There is a process of categorisation that would work equally as well with the works other representations (seascapes/mountainscapes and spaces inner/outer). Each theme is linked phenomenologically with narratives of the work but each would stand as page layouts again of main plate and plate of earlier images at a smaller scale.

This is not the final piece, but thus far it has an appeal. It leads to making and it does so in a structured way and way familiar to the author and in some respects reflective of Victorian categorisation schemes e.g. in Botany.

To take this a stage further is to keep a keen eye on an Exhibition element of publication. Having learned from visits of a knowledgeable public to a Summer exhibition of recent work, the idea would be to take from this experience the things that worked well with the audiences especially around sequenced narrative and incorporate it into the same book design mentioned above. A book section that parallels an Exhibition.

There then becomes a substantive element of making to propose and gather feedback on from the University regards the standards of the MA Photography course. It would also be necessary to maintain balance, i.e. not try and squeeze a long term project into the remaining time on the MA.

What this is about is the practicalities of making images of publishable standard, about a book and about an exhibition.

There are extras planned either to assist the design such as using ISSUU as a template for hand, bookbinding. Or, to help create impactfully contextualisation by making moving stills and or a video. This created the atmosphere at the earlier summer exhibition.

The exhibition has some elements that are rooted such as the available space and the possibility for lunchtime pop-ups during appropriate photographic training sessions. Some elements would be more aspirational at present, such as making society presentations at one or both societies with which there is an affiliation. This is a likely outcome but does not have to happen within the timeframe of the MA, it can follow on. Another group or in fact two groups have made approaches although generally so and not so much around a specific project.

The aspirational elements represent To-do action if something is to be achieved. For the purpose of the MA and continuity, it might make sense to negotiate with the various societies and groups, the further taking of the work to public view but time this to allow freedom to complete substantive work for the MA without too much self-imposed overload.

PHO705: Visual Language of DNA Testing

There are different commercial services that provide DNA testing connected with ancestry. One service is mentioned here as they have an option to have a personalised book and that fits well with researching visual language of DNA. Two services were inspected:

This is a continuation of earlier research. It looks at a specific book product of commercial DNA testing. The idea is to gain awareness of public perceptions around DNA by examining the visual language used by a company promoting DNA testing.

This current phase of research is prompted by the order and eventual arrival of a personalised analysis “Your DNA Adventure” (LivingDNA, 2019).

The content is predicated on three types of DNA we possess.

  • Family Ancestry (autosomal DNA)
  • Motherline Ancestry (mtDNA)
  • Fatherline Ancestry (Y-DNA)

As the photo project majors on the Motherline (a term now preferred to matriarchy as it softens potential for feminist bias.

The motherline is highly stable over thousands of years and once a change does occur it is passed down to descendants. The top-level term used is Haplogroup within which exist Subclades.

Descriptive language then takes over preventing opaqueness and is a strategy noted elsewhere for keeping others engaged.

There is a very good reference section to explore.

Within the publication the visual themes range across:

  • trees on African savanna (covers)

Note: The visual references are probably best viewed as a publication rather than my translate to text here.

Bibliography

LivingDNA (2019) Michael Turner – Your DNA Adventure.

PHO705: Research Artsci, Communicating Science Visually, Computational Biology and a new Avante-Garde

Following the visit to the Wellcome Museum, it was clear that others must be working in an area where art is created from science.

Artsci is the term coined in the book (Miller, 2014) where Artsci acknowledges a convergence of Arts, Science and Technology.

Colliding Worlds – How Cutting-Edge Science is Redefining Contemporary Art (Miller 2014)

The work in bulk extensively sells the market for Artsci, by giving innumerable personal reflections on individual contributor after individual contributor, yet this is rebalanced in the final chapter by doubts over the acceptance of Artsci in restricted / specialist galleries being deemed almost gimmicky as an art form. However, examples are made in the ending of the rejection of Picasso and the Impressionists who had to set up their own groups. And so it is left to the reader as to whether or not to take up the “cause” of Artsci.

Millar describes the technical evolution of technology in computing in this book (Millar, 2014). So much resonates with my early career in technology as a world in which artist and scientist no longer are viewed strictly different disciplines. Art and science and engineering are disciplines seen as having a conceptual touchpoint in terms of methodologies e.g. minimalism and cubism.

An electronic signal called a butterfly transform, photographed on Polaroid film, was one of my earliest technical visualisations. I designed and built an electronic circuit to automatically tune to a signal frequency of a type used to communicate with deep space satellites. The active tuning process was viewed on an oscilloscope and the overall capture presented on film. During development one of the early characteristics was that of a squegging oscillator which pulsed on and off due to design tolerance issue in this automatic circuit. This was around the time that a successful MSc application was made to study the subject of Cybernetics that involves the control of machinery using feedback and software controllers. A funding issue arose that prevented the place from being taken up. Besides this, an economic downturn occurred that would certainly have blocked an immediate return to research and development within the industry.

The book runs a direct parallel to my early involvement in computing, discusses the various technological art movements and the establishment of schools for such art.

The book also discriminates between Media and Fine Art the former being linked to crafts and it notes the rejection that occurred on many fronts.

However, with repeated incursions of technology into art and advances in the modern world, it is argued that contemporary art can no longer exist without the structures and knowledge of the scientific world and they are seen to combine.

Artists are seen to look towards science and without getting directly involved with expensive equipment instead read the ideas and then through contemporary art communicate these ideas. Scientists look towards artists to understand how they approach a topic e.g. Nils Bhor and the wave-particle dichotomy of physics and the resolution of this through Picasso and the advent of Cubism, where it is fine to have multiple perspectives present all at once.

The question has to be where does this lead to in terms of the Final photo project? Well, it resolves why the author takes a technological view of art and provides an independent and solid standing. The intent of the work becomes understood in the wider context.

The book identifies the avant-garde as being the convergence of art, science and technology and it is seen as an exciting frontier in Contemporary art.

There is a summary for Antony Gormley, his influences including in science, and his work which was on display in London during visits there.

Another outcome is a strengthened resolve so as to honour or be true to one’s life experiences. Otherwise work would remain conflicted.

Had this work been uncovered earlier in the course, there would have been the time need to develop programmed work such as animations. These would be over and above the glow images attributed to mtDNA. What there is also are elements of identification (determined through psychoanalysis).

The book has been difficult to put down and yet the historical side has to stop at some point to allow time for project progress.

Computational Biology – Human Proteome Folding

Following a career in research and development in electronics and computing, sometime later, there was a formative even if only a side involvement in grid computing donating spare machine cycles to do then return completed calculations to researchers in computational biology. This was in the search for new drug treatments.

Specifically, spare machine cycles were donated to human proteome folding projects. These projects are highly visual as protein formation and attachment is shape-dependent.

These projects go back to around 2004 and there is little visual material remaining. In lieu of this, a TEDtalk was discovered that ably shows the visuals (Dill, 2013).

For 50 years, the “protein folding problem” has been a major mystery. How does a miniature string-like chemical — the protein molecule – encode the functions of living organisms: how our muscles exert force, how our immune systems reject pathogens, how our eyes see our surroundings, how plants convert solar energy, and all the rest. Huge progress is being made. Moreover, these amazing nano-machines could play important roles in health and disease and commerce in the future.

(Dill, 2013)

What this post identifies is what is behind the intent in making the photo project.

Art of Now

Research uncovered a BBC Radio 4 broadcast Art of Now. (McNamee, 2019)

Recombinant Rhymes and DNA Art

The successful sequencing of the human genome has not only had huge implications for medicine, bio-technology and the life sciences – but it has also provoked a great and growing reaction among artists and writers.

Anna McNamee meets poets, visual artists and scientists collaborating creatively on the frontiers of DNA science in a genre that Pulitzer Prize-nominated author of AI Renaissance Arthur Miller calls Art Sci.

In Melbourne, the bio-animator Drew Berry tells how his dramatic but scientifically exact visualizations of cellular and molecular processes have earned him fans around the world – including the musician Bjork. 

The poet Sue Dymoke and the structural biologist Pietro Roversi reveal how their creative partnership has resulted in a three-dimensional, topsy turvy poem called DNA Time that mimics DNA’s unique and complex structure. 

In his lab, the Canadian experimental poet Christian Bök has successfully encoded his work into the DNA of a bacterium creating what is essentially a living poem.

While at the European Bioinformatics Institute near Cambridge, the artist and filmmaker Charlotte Jarvis and the scientist Dr Nick Goldman have stored music in DNA which they then suspended in a soap solution and used to blow bubbles, quite literally, bathing their audiences in music.”

(McNamee, 2019)

Drew Berry

Drew Berry is a biomedical animator at the Walter and Eliza Hall Institute of Medical Research in Melbourne, Australia. He produces animations of proteins and protein complexes to illustrate cellular and molecular processes (Berry, 2011).

Wikipedia

Animation Development

Berry describes the molecular level being sub-light wavelength and how he gained inspiration from the accurate scale drawings of David Goodsell:

Beyond this Berry incorporates measurements of cell dynamics and microscopic observations of larger cell structures to create his animations. His intent is to make work that viewers can take-in with avoidance of technical descriptions and acronyms which otherwise make the subject opaque and turn off the viewer (Berry, 2012)

Animations from Berry and molecular biologists and cell biologists:

Bibliography

Berry, D. (2011) Animations of unseeable biology. Australia: TEDxSydney. Available at: https://www.ted.com/talks/drew_berry_animations_of_unseeable_biology?language=en.

Berry, D. (2012) Communicating Science Visually. USA: The Broad Institute. Available at: https://www.youtube.com/watch?v=y19lKbvJZys.

Dill, K. (2013) The protein folding problem: a major conundrum of science. TEDxSBU: TED Talks. Available at: https://www.youtube.com/watch?v=zm-3kovWpNQ.

McNamee, A. (2019) ‘Art of Now Recombinant Rhymes and DNA Art’. A Whistledown production for BBC Radio 4. Available at: https://www.bbc.co.uk/programmes/m0002rkb

Miller, A. I. (2014) Colliding Worlds – How Cutting-Edge Science is Redefining Contemporary Art. New York and London: W. W. Norton and Company. Available at: www.wwnorton.com

PHO705: Research – Phantasmagoria

General

Having recently communicated progress and details of research themes for the Major Project, the action has triggered several responses in terms of recommended reads. The objective remains to build research into the contextualisation of practice while developing the visual language.

This blog post concerns Phantasmagoria Spirit Visions, Metaphors and Media into the Twenty-first Century. (Warner, 2006) Ideas of “spirit”, “soul” and the “supernatural”.

Summary

The book (Warner, 2006) challenges why it still is that in the 21st century we revert to ideas of “spirit”, “soul” and the “supernatural”.

Scanning through this text there are two areas of immediate interest with regard to the photo project. First is a quotation.

“You are on a mission to discover

why the human heart still slows

when divers break the surface,

why mermaids still swim in our dreams”

“Michael Symmons Roberts, Mapping the Genome”

With a project theme majoring on DNA there is almost a necessity for discovering why Warner included a reference to the Genome. (Warner, 2006) opposite Page xviii

Further search shows that Symmons Roberts in 2003, soon after the Human Genome was decoded, penned another poem about the Mapping of the Genome and written in a metaphorical style of a car journey along a seemingly unending straight desert road.

Other areas of the text that prompt immediate interest are Part V Shadow Part VI Mirror: Double Vision, The Camera steals the Soul, and Part VII Ghost: Stay this Moment, Julia Margaret Cameron and Charles Dodgson; Spectral Rappers, Psychic Photographers.

Topics with a stronger connection to photography than literature demand more attention in the project context.

Online Video Lectures

The book author is a renowned presenter and her interviews, presentations and lectures are available to view online. This gives quite a quick view over a range of subject matter.

Much of what is presented is based around stories and fairytales and is literature-based rather than strictly photography based.

Quotation

Bibliography

Warner, M. (2006) Phantasmagoria Spirit Visions, Metaphors and Media into the Twenty-first Century. Oxford, United Kingdom: Oxford University Press.

PHO705: Guest Lecture Laura Pannack

Artist website: https://laurapannack.com/

The website has a shop portal with items that can be purchased. There is also an image of the week blog which Laura endeavours to update each Thursday or best she can.

Laura is an artist whose work is based on portraiture. At first, there appears to be no overlap with the photo project, yet when archive images are included for contextualisation, then there the overlap may become apparent. Laura makes her own portraits of course, where those with a connection to the photo project are from the family archive.

The introduction – a social documentary photographer, producing self-initiated, private projects for Laura.

Two questions – how do we make work? Why do we make work? Laura’s work is Fine Art, Social Documentary.

She was encouraged to try every genre while studying at university. Having a younger sister enabled Laura to explore an interest in teenagers especially given there was access. Noted characteristics of teenagers were awareness and lack of self-awareness.

Laura is engaged in commissioned artworks and short term projects. She always has a desire to learn about her subjects. Consideration is given to “what is it that interests me about the subject?” Working on a commission means working to a deadline, which depending on the individual, can be really useful. It has often led to good research done on time and the commission ensures work is completed.

One commission Digital Self Esteem, Selfies and self-worth, related to the selfie culture and was produced for the Saatchi Gallery. This used two-way mirrors and allowed the teen to settle their gaze on themselves for 20 minutes for each shot. Another commission Separation, What does Brexit mean for love, was for the BJP. The first thing was to realise a limitation over politics of not being well-read enough or intellectual enough. It made sense to go back to what the artist knew and the work rested on relationships and love. Tests were made using a latex screen in a studio. Photographs depicted couples likely to be torn apart by one of them having to return to their country of origin. The chosen approach was not too controversial.

Working Methods

In determining the working method, there are the following: what’s your voice? What is your sense of style?

Sometimes it is a relief to not to think too deeply, but normally Laura does research long and hard.

Searching for a sense of style

We were challenged to think about our sense of style and comment on what our signature style is.

Sometimes you can look at an artist’s work and recognise the style. You then may wonder if they will ever break out and do something dramatically different, do something really wild.

Hockney was able to paint on an iPad and was able to take the risk. HE can do this as he has done everything else so well.

People

Sometimes it has been a case of learning the hard way. You need to be clear about your reason for approaching people.

Portfolio Reviews

Portfolio reviews are an excellent way of gaining feedback and need to be structured: what is your reaction to this and why, then how can improvement?

Long Term Projects

Young British Naturists

Young British naturists was a long term project and involved an immense amount of relationship building, organising and planning. The personal project gave the opportunity to take control. “We’ll be shooting over here if you can gather”. Then when a shot seemed likely, the lighting was set-up.

Over a two week shoot, 36 rolls of film were used, but due to a camera fault, only one image was salvaged. A great deal of care was taken to adjust the positions because of the nudity.

Purity

Purity ran over eight years. The intent was to bring out love, family, traditions and femininity within the Jewish community. Preparation included working in local clubs to get into the community. However, barriers remained – Jewish women did not want to be photographed. The work initially focused on three families but this reduced down (or was reduced to) just one. Photographing meant going back to the same room every time.

Youth Without Age

Youth Without Age, An exploration of the fragility of life derived from a sense of age slowly advancing. Sketchbooks were kept. The subjects also sketched. Old Romanian films and theatre productions were watched. Cynically, perhaps other artists work was analysed e.g Alec Soth and his use of water.

The Cracker

Just be with people and shoot. A voice in the back of the head kept asking, “Why are you shooting”.

Projects in General

Some projects ran over 8 or 9 years, while with others it was a case of just shoot.

A visual notebook is kept with images stored on Dropbox. Here they are always available for inspiration. This is useful when making new commissions.

One project involved selecting a railway destination at random i.e. selected with eyes closed. A day would be spent shooting at the selected location. The weekly image blog is updated every Thursday with one picture with a reason why.

Laura is a guest on A Small Voice podcast.

PHO705: Omnis Cellula ex Cellula

… all cells come from a previously existing cell.

This research arises from a connection established with a geneticist. The value here is in the development of visual language for contextualisation of the photo project.

Mitotic Division is examined by augmented reality with the following app and educational workbook:

Note: Select English under the triple bar menu

The emphasis moved closer towards an interest in mitochondria explored in another recent blog post. While there is an abundance of archive images that explore the matriarchal lines of family, the visual context around genetics is being developed having been more restricted materially and in terms of ideas, which are constantly being expanded.

Use

The pdf says to print off the guidance – the app seems to work when reading the graphics directly from the screen graphics when Adobe Acrobat (or another reader is used).

Exploring the Intersection of Photography and Computed Visuals with Processing: An Experiment with mtDNA and Animated Teeth Narration

Combining photography with computing can lead to some exciting and innovative visual experiences. One way to achieve this is through the use of Processing, a programming language that allows for the creation of dynamic and interactive visuals. As part of my FMP research, I have been considering the use of Processing in connection with my photography, specifically around the topic of mitochondrial DNA (mtDNA).

Mitochondrial DNA is a type of DNA that is found in the mitochondria of cells and is passed down maternally. This type of DNA can be used to trace ancestry and is also important in understanding genetic diseases. By combining photography with dynamic visualizations of mtDNA, I hope to create a unique and engaging experience for viewers.

To achieve this, I plan to add a layer of computed visuals to my photography using Processing. One possible approach could be to create an animated representation of mtDNA that responds to user input, allowing viewers to interact with the visualizations in real-time.

In addition to using computed visuals, I also plan to incorporate animated teeth as a narrator in my project. To accomplish this, I will be reusing code from an earlier course on Processing. The code for the animation is shown below:

float toothY = 0;
float toothDir = 1;

void setup() {
size(400, 400);
noStroke();
fill(255);
frameRate(45);
}

void draw() {
background(0);

// Update the tooth position
toothY += toothDir * 5;
if (toothY < -30 || toothY > 30) {
toothDir = -toothDir;
}

// Draw the teeth
pushMatrix();
translate(width/2, height/2 – 60 + toothY);
scale(0.5);
drawTooth(-80, -20, 30, 60);
drawTooth(-40, -10, 20, 50);
drawTooth(0, 0, 20, 40);
drawTooth(40, -10, 20, 50);
drawTooth(80, -20, 30, 60);
popMatrix();

pushMatrix();
translate(width/2, height/2 + 60 – toothY);
scale(0.5);
drawTooth(-70, 10, 20, 40);
drawTooth(-30, 20, 20, 50);
drawTooth(10, 20, 20, 50);
drawTooth(50, 10, 20, 40);
popMatrix();
}

void drawTooth(float x, float y, float w, float h) {
beginShape();
vertex(x-w/2, y);
bezierVertex(x-w/2, y-h, x+w/2, y-h, x+w/2, y);
vertex(x+w/2-w/5, y);
vertex(x+w/2-w/5, y-h/2);
vertex(x+w/5, y-h/2);
vertex(x+w/5, y);
endShape(CLOSE);
}

This code creates a simple animation of 10 teeth that move across the screen from left to right. To run this animation on Mac OS, you will need to download Processing version 4 from the Processing.org website. Once downloaded, simply copy and paste the code into a new sketch and click the “play” button to run the animation.

Mitochondrial DNA Example Sequence

While my own DNA has been decoded, I cannot share the actual coding due to privacy concerns. However, I have used a mitochondrial DNA sequence as an example in a photograph of my paternal grandmother, as part of a project to trace my father’s ancestry. I plan to create similar visualizations using antique photographs of my maternal grandmother and great-grandmother from my family photo collection.

GTGCTGATCACAGGTCTATCCTGACCTGGCCGAGCAGGAGAGCCTCTGCAACCCGGGAGGCGGGAGCATTGATTAGCTCACTAAACCCCCGCCCTCAGCCTACTTAAATTTAATTAAGCCATCGGCGCACGGTCTTTTATTAGCTCTAGTCAAAACTAAAGAGGGTTCGCTTTAGCCACACTGGGAGTGGATCACCCGTTCTCTACTAAAGTGTGCCGGGGGAGGAGCCTGTTATTT…

There are different methods to create the desired type of image. In Photoshop, one approach is to write the letter sequence as text attached to a marked-up line, which could be spiral in nature. Alternatively, a simple layer could be added to an antique family photograph. Another option is to use Processing to run a program that generates an image from the letter sequence, such as Text2Image.

The latter was implemented and is the more sophisticated visually. Text size and colour is varied to produce a form of typewriter art. Experimentation with parameters was clearly necessary from a previous implementation which was either too crowded with text or too sparse. I need to find the happy medium.

The more sophisticated approach for creating the image was through Processing’s Text2Image program, where the text size and color can be varied to produce typewriter art. However, experimentation with the parameters is necessary to find the right balance. In a previous implementation, the image was either too crowded or too sparse with text, so I need to find the sweet spot.

By combining computed visuals with my photography and incorporating animated teeth as a narrator albeit quite basic until further refined., I hope to create a unique and engaging experience for viewers that explores the topic of mitochondrial DNA in a new and exciting way.

PHO705: Easter Reflection

This an important Milestone in my assignment plan.

Hand in statuses

FMP Proposal 10 points

Status Green – submitted and marked at Week 4

FMP Critical Review Journal CRJ 10 points

Status Amber/Green – up to date with around 4 more posts to make.

Important Note:

  • All FMP entries are titled by module identifier PHO705
  • Search is provided- page all the way down to view the tag cloud, category selector and search box.

Link michaelturnercrj.blog

FMP Critical Review of Practice 20 points

This is ready for review.

FMP PDF 60 points

Status Amber/Red – completion is dependent on making that’s work in progress.

The FMP PDF is WIP:

Exhibition Prints

Status Amber – poster board printing and edit of 50 down to 20 images is lined up to start. Materials available and inks replenished.

Book

Status Amber – interview text and some poetry/prose is written and ready for an edit. The picture edit is to be tightened up and layout created in InDesign. This is a time-consuming activity. The book was proposed by the University as the replacement activity of the postponed exhibition.

ISSUU

An electronic publication on ISSUU is a step in visualising the book before printing and hand binding.

Portfolio Website

Status Amber – draft published pre the edit. The picture edit is in work.

Link: https://www.michaelmturnerphotography.com

Other Elements

Status Red – these activities have been prioritised down in favour of the marked assignments and in line with Exhibition postponement.

Note: the August 2019 exhibition ran for eight days for the same project with the last module images. The other elements were used for that.

Supporting elements to be remade: audio recording, moving stills, and video.

Review

I’ve planned to gain review, some is in and other practitioners will need the items above to make comment.

This will be my final stage adjusting to the public presentation of my FMP and a vital opportunity to make adjustments before handling in.

PHO705: Easter Reflection

The Final Major Project is expected to adapt to the COVID-19 outbreak.

Falmouth University Self-help

A series of Thursday meetings have been run or engaged in for students as a Final Major Project cross-cohort group. We are all affected by the pandemic that is currently peaking.

Effects of imposed social isolation are many, from not being able to shoot project images anymore, through to cancelled exhibitions.

There is increased engagement from our tutors and module leaders at this time with many inspirational guest lectures.

A personal challenge, exhibition apart, is simply writing with distractions and increased communications with families and through a media storm.

Completion of the MA

There are two key communications:

  • PhotoHub – Announcements – ECs Updates from the University Course Leader 20 Mar.
  • Office of the Vice-Chancellor 3 Apr. Coronavirus: update on assessments.

I’ve really no idea how to fully interpret these in my circumstances, without stopping to clarify. With time already lost to the pandemic, I cannot sustain too much more delay.

As for self-isolating, I’ve been isolating in effect since the end of September and I’m quite used to it now.

My work was designed to be sustainable from 3 months into the course. If necessary I could simulate glow using pressure marks in a similar way to exposing photographic paper.

As for making I planned in advance and have enough materials for printing and book binding. The main problem is the writing of a 20 point review that has taken an inordinate time and is currently 2/3 rds of the way through it third incarnation.

In a sense, it is needed in advance of making as the guiding intent. But then it can’t complete until the work has gone public. I think the Critical Review of Practice CRoP should be renamed the Catch22 Review of Practice CRoP because of this gotcha. I hope this entanglement might be recognised for future cohorts.

PHO705: Week 22 Reflection

Reflections, Reflections, Reflections

A Writing Review

Never make this mistake. Go to review early but not too early.

FMP calls for multiple unplanned writing requests. Show me the ticketing blurb. What does your artist’s statement say? What is the context of this work? Random creative scribblings for the book front stuff with raw poetry, a collection of quotes and an interview. Add to this list this very CRJ.

An outcome has been the abrupt realisation that the writing needs to be planned

Reflections on the pandemic spread of SARS-CoV-2

Handwashing

Hand washing is Government advice and in turn, frequent hand washing has led for some to minor healing from drying and cracking.

Colour has returned to my work on this latest adaption to my FMP:

[metaslider id=8759 cssclass=””]

Deep Sequencing

The outbreak of the Corona Virus on a cruise ship was sampled and deep sequenced by scientists in Japan:

Despite the length of this nucleotide, a virus is a very simple molecular mechanism compared to our genome. Here is a visual rendition created for the virus to summarise all of the nucleotides you see in the PDF:

Factoids – Genetic Research

My FMP work can get really deep and intense and involved and I’m sure the intensity can be too much for the casual viewer of the work. This is becoming ever so clear as a result of making a synopsis of the Critical Review of Practice and book content.

A bias entered the FMP by deciding to place focus on own DNA (at a meeting with Victoria Forrest). I have since analysed 680,000 lines of my genome and revisited the book “Your DNA Adventure” (Living DNA, 2019). The language used there is straightforward to follow. It is better than my own writing that is based on two months of genetic research made possible when being laid low twice (or thrice) last year with the visit of a nasty virus.

Here are the snippets that inform. I like to call them factoids.

Motherline MTDNA Haplogroup T1a Subclade T1a1a arose in a woman in the Mediterranean 17,000 years ago. Inherited directly from mother.

Fatherline Y-DNA Haplogroup R-L21 Subclade R-DF25 Atlantic shores of Northern Europe. As male inherited from father.

Autosomal DNA cover the last 250 years. The FMP covers just over 100 years to the Great War. The first 22 (of 23) chromosome pairs form the autosome.

680,000 markers are analysed from my genome.

I am of Scottish cultural descent and now certified as Irish with Norwegian trace from the Viking invasions. This links me to Celtic legend and a tribal genetic legacy.

The genetic signature has a quality unusual in the British Isles linked to migrations in the 1600s but intermixing occurred before then with natural migrations across the sea.

Remarkably DNA can be traced back to nomadic Stone Age people at the end of the last ice age. The signature is found in Western Germany, Northern France and Belgium. It is therefore ironic that brothers from my family who fought in the Royal Highland Black Watch Regiment, fought their ancestral brothers and died fighting in France and Belgium.

I have a common motherline ancestor with peoples living in Udmurtia, Romania, Tunisia, Iran ant the Caucasus.

My common ancestral mother would have been a hardy hunter gatherer. Competition for resources would have been fierce. This character lived on in my mother and was present in her representing southern Scotland in as a sprint runner. The hunter gatherer tradition lived on in living memory in the Scottish community I was born into and lived within. A tradition that lasted for 17,000 years of which I may be the last in line to witness these events.

My fatherline hails from Ireland, Wales, Brittany, Scotland, England, Netherlands, Norway, Switzerland and Germany in an Atlantic Celtic migration arriving in the early Bronze Age. In fact my father was lined up to be the village blacksmith before he left to join the Parachute Regiment.

Mitochondrial DNA exists as circular cells outside of the chromosome nucleus. The egg contains thousands of mitochondria and the sperm very few. These are mostly in the tail which is lost during fertilisation adn so mitochondria is inherited from the mother. It is thought there may be one or two individuals alive who improbably inherited the mitochondria of the father. Mitochondia are very stable and can be assumed to mutate once in every 1,000 years. The Salamander and even wheat have greater DNA diversity than humans.Genetic diversity is very limited in modern humans outside of Africa.

Africans who are resistant to malaria received a gene 33,000 years ago. Europeans had already migrated and so do not share the resistant gene.

Although my DNA is unique, it is over 99% in common with every other human being alive. Our genetic connections with those in different regions have more in common than in our geographic separation.

While Crick and Watson won the Nobel prize and are credited with the discovery of the DNA double helix, their work actually used the results of X-Ray crystallography created by Rosalind Franklin at Kings College London, who was not credited.

Last year at a Symposium led by women on the subject of the parallels in thinking behind the art, and behind science, I met a husband of one of these eminent scientists. The husband took my research question and replied, and I asked if he had been at Oxford. No, he was Professor in X-Ray crystallography at King’s. But if that was not enough coincidence, when I said I’d been at the Oxford Department of Zoology on the Computing side of X-Ray crystallography, it turned out he was there doing his degree that same year.

And finally, when the 1951 discovery was made what knowledge previously existed? Plato (428 BC-348 BC) a philosopher and mathematician in Classical Greece wrote in “Tinneus” of the creation of man and used terms that directly parallel the modern science.

Bibliography

LivingDNA (2019) Michael Turner – Your DNA Adventure.

PHO705: Week 21 Reflection

The exhibition will now take place in a silent studio and plans are afoot to make a video presentation. Maybe in expansive mood perhaps also an artist talk.

Silent Exhibition

What to say when narrating the exhibition? Some plans are afoot as to how to conduct this but what to say. Perhaps make a reading of the book front stuff: prose going into poem and artist interview.

Versus Alternative Venue

Plan B would be to leave the studio and use brick walls and lighting I have lined up. Would it make a difference to the interpretation of the work, well yes?

A venue change to a brick built environment reminds of the following with lyrics following on to some kind of parallel to the pandemic:

Inspired by music and the feel of an alternative venue and the reason behind the change of venue:

Empty Spaces – Pink Floyd

What shall we use to fill the empty spaces
Where waves of hunger roar?
Shall we set out across the sea of faces
In search of more and more applause?

Shall we buy a new guitar?
Shall we drive a more powerful car?
Shall we work straight through the night?
Shall we get into fights?
Leave the lights on?
Drop bombs?
Do tours of the east?
contract diseases?
Bury bones?
Break up homes?
Send flowers by phone?
Take to drink?
Go to shrinks?
Give up meat?
Rarely sleep?
Keep people as pets?
Train dogs?
Race rats?
Fill the attic with cash?
Bury treasure?
Store up leisure?
But never relax at all
With our backs to the wall

PHO705: Week 20 Reflection

Practitioner Feedback

A practitioner was approached for feedback and this turned into an immediate request to see the portfolio online. This seemed too soon as the different activities have still to come together into a whole.

Initial indications are about the work being striking and original and as test prints, at 4×5 inches they would be better viewed at greater than A4 size. A3+ posterboard on order has now arrived and is ready for printing.

Looking at the care instructions I was surprised to read the small print. Matte posterboard being a heavy-duty option compared to gloss photopaper requires more care. It has to be covered in an absorbent paper when taken out of the printer. It then needs 24 hours to fully dry and for the colour to fix. Then it needs mounting behind glass.

I’m glad there was time in the plan to allow for this unexpected activity.

All of this because the size of the images matters. I’d normally go to A4 so the prints are going up in scale.

As mentioned elsewhere , I’m willing to give it a go. It could be an expensive failure and I might have to revert to my standard A4 on 40x50cm mountboard.

The cancellation of the exhibition means it could all be counterproductive anyway. The revised intention is to film the setup on iPhone and add a spoken narrative. I’m going to have to deal with iPhone stabilisation issue, but I’m sure that can be managed.

I can see me doing a practice run with a planned and edited spoken word displayed on a teleprompter. These things require a team effort because so many hands are needed and the delivery requires practice. If I’m pressed the video might be released. My concern is about introducing new technology at this stage on top of 3D modelling tools Sketchup, and Vectorworks, Generative art software Processing and P5.js and Wordclouds. I really need to concentrate on the marked elements of the course.

The poster-boards will bring a whole new challenge to taking the work public regards unfilled white space. The finish is matte (when glossy was my intent). Size is large (when my original intent is memento based). Then there is the need to re-layout the images and there is the increase in size and weight for 30 prints.

If this goes badly wrong at least I should have some nice individual prints over and with enough mount-board ordered I can repeat the whole exercise on A4 gloss. This variation from plan doubles my workload and in circumstances where an exhibition may be postponed with the current virus threat to society.

Another constraint is the supporting material of which video and exhibition guide are examples that require time and effort and may not get to be appreciated or shown even in public.

Re-emphasis, as now expected by the University, is towards the book. This was never meant to be the main public deliverable only an artist’s book dummy as a keepsake from the exhibition. Taking the book to the main deliverable makes this a serious concern that normally requires collaborative input and the design assistance of a graphic designer. It is widely known that photographers on the subject of their own work are poor at bookmaking in terms of selection of edit, layout, graphics design and writing.

Would it be wise to follow this direction as the work is not going to be shown at its best as working with a graphic designer and printer requires three months elapsed and there is only 6 weeks or less remaining?

This global virus pandemic is really destabilising the end product quality. It is a killer in the normal sense of health but is also a killer with the additional contingency planning and actions and new methods of making required. It is a great shame to have a two-year build-up to the end of the course and then have this destabilised in the planning and acting at the final stage.

All this effort and the prospect, not so much of a good outcome that reflects engagement, but the question and doubt, will the outcome even be a pass?

Exhibition Re-planning

The exhibition is in an advanced state of planning and now for contingency planning as the global alert has increased over potential COVID-19 pandemic. Update: The WHO has now declared a pandemic. The Falmouth Vision 2020 event is still going ahead thus far/ did go ahead – I decided to avoid the risk.

Yesterday it was announced that the NEC Photography Show is to be postponed until September. Over the next month, the situation has the scope to change even further.

The current state of 3D modelling has been advanced again this week to include the first photograph on display. Here is a more simplified model and detailed model.

Layout identical to the summer exhibition except triptych layout becomes a run of six images

Titled deja vu as the 3D render is eerily like being at work. There are still some simplifications such as walls that are hidden so as to aid both construction and the ability to walkabout within the 3D space. The final edit has yet to be decided but when ready (soon) my photographic images will appear within the mounts. One is shown at the moment.

Narrative Quotations of Past Present

I’ve researched some narrative quotes for my Critical Review of Practice and front stuff in the Artist’s book. I’m going to choose two from the three I think, probably eliminating the harder to follow. Let’s see.

  1. The Moment of Hearing

“The moment of hearing appears to be the moment of writing, for it is only in the recapitulation that he hears the bird.  Experience is an a posteriori reconstruction that does not make the past present to consciousness but projects it into the future: “O you demon, singing by yourself projecting me, O solitary me, listening never more shall I cease imitating, perpetuating you” 

2. Memory

“Memory, as philosopher James Booth states in his recent book Communities of Memory, “memory is centered on an absence, tries to make it present, and in this effort answers the call of the trace. “Traces are markers pointing to “a past that dwells in the hollows of the forgotten” I call these traces “memory texts” in any form, be it a map, a story, a landscape or a building or a monument, or a ritual, a performance or a commemoration, … You and I participate and share these memory texts, feeling that “the call of the trace” makes the absent past present. A memory text is nearly always a space of contestation: different people attach different meanings to the same semiophore, they remember the same event differently. The … collective memory of the … War is shared by people who have not experienced the war or the anti-war”

3. Back in Time

“… practices performed by the family members produce movements in three directions; it transports the members of the … family back in time as well as it makes the past present and, last but not least, the image itself makes sure that the family is remembered in the future. Finally (hopefully), in the end, the portrayed members of the family will be granted a place in heaven.”

Quotations chosen from English Web Corpus enTenTen15 under SketchEngine with CQL query [word=”Past”][word=”Present” & tag!=”V.*” ]

The query eliminates the Verb Intransitive form of Present.

Exhibition Ticketing and Announcement

The announcement was created for the exhibition including a description thus:

“Past-Present explores the experience of identification with an ancestral past linked through the modern science of genetics. The author’s genome is decoded and shown within the work mixed with a trace of healing glow. 

The family previously unknown from “Galloway’s Great War” who fought in the Royal Black Watch, are reconnected with, in a commemorative work that bridges to history over 100 years ago. As a photographic work, there are visualisations throughout of imaginings and fading memory of childhood of places common, including agricultural and coastal lands. The science connects trace of human healing glow with wounding suffered by those injured who returned to battle and were lost in the Great War.

A style of word cloud visual, inspired by a genre of poetry known as Recombinant Rhymes and helps guide the narrative. 

Opening times 14:00- 17:00 on public days Saturday 11th, Sunday 12th and Monday 13th April.

With the kind support of Simon Ellingworth multi-genre multi-award-winning professional photographer and studio owner at Amersham Studios. Part of Trade Secrets Live, trainers for Royal Photographic Society workshops and premium training by international photographers and digital artists.”

Contingency Planning

In case the Easter exhibition has to be postponed, some options are being considered without yet knowing what would be best at satisfying the course requirements:

  1. Continue with handbound artist bookmaking but make a public offering via one of the commercial book sites.
  1. Extend the 3D environment I’ve part built this week for the Studio/Gallery space and send a link for viewers to browse the installation. I’m not sure if this will require viewing 3D drawings in SketchUp Pro 3D via the downloadable SketchUp Viewer or move everything over to VectorWorks software which allows browser viewing. Taking this to the next level of Augmented Reality AR would be a push given the time left in this module.
  1. Set-up the studio space as planned (football is currently being played behind closed doors) and provide panoramic viewing or live Whereby access. Potentially I could record an artist talk (an unrecorded one was given at the summer trial exhibition, and feedback was recorded.
  1. Still, go ahead with the new commercial website https://turnerphoto.art and academic portfolio website https://www.michaelmturnerphotography.com/shop-11
  1. Still, go ahead with the moving still presentation with delivery via Vimeo.
  1. Expand the facsimile print exhibition in a box and send out a package to specified reviewers for their critique. It might require that a PO box of some sort be set up for privacy. 

Bibliography

enTenTen15 (2020) SketchEngine. Available at: https://app.sketchengine.eu/#concordance?corpname=preloaded%2Fententen15_tt21&tab=advanced&queryselector=cql&refs_up=1&itemsPerPage=100&structs=s%2Cg&refs=%3Ddoc.website&default_attr=lemma&cql=%5Bword%3D%22Past%22%5D%5Bword%3D%22present%22%26tag!%3D%22V.*%22%5D&operations=%5B%7B%22name%22%3A%22cql%22%2C%22arg%22%3A%22%5Bword%3D%5C%22Past%5C%22%5D%5Bword%3D%5C%22present%5C%22%26tag!%3D%5C%22V.*%5C%22%5D%22%2C%22active%22%3Atrue%2C%22query%22%3A%7B%22queryselector%22%3A%22cqlrow%22%2C%22cql%22%3A%22%5Bword%3D%5C%22Past%5C%22%5D%5Bword%3D%5C%22present%5C%22%26tag!%3D%5C%22V.*%5C%22%5D%22%2C%22default_attr%22%3A%22lemma%22%7D%2C%22id%22%3A791%7D%5D.

PHO705: Falmouth F2F

Visit Falmouth, take part in workshops and have work critiqued – at least that was the original intent. A COVID-19 pandemic put an end to F2F for myself.

Some engagement is/was possible through online delivery.

Zed Nelson Q&A (Thursday evening)

It was somewhat strange attending a Q&A for a film premier not seen. Nevertheless, being familiar with the area of London, the subject of the film meant it was possible to get the gist and follow along.

Guest Lecture Jo Coombes

A presentation on carbon footprint and zero carbon shooting or filming.

[metaslider id=6988 cssclass=””]

A selection of slides Jo Coombes from Canvas Lecture

Guest Lectures Saturday Toby Smith

Although aimed at climate change, the subject matter centred on effective campaign communications based on social science or indeed marketing.

The parallel with my project work is taken and guidelines are extracted that may improved the messaging.

[metaslider id=7141 cssclass=””]

Keywords were taken as narrative, authenticity trusted communicators, identity and values and apply to my FMP project.

Another important element to my FMP is with the negative messaging of loss to have a positive for people to switch their emotions to.

Strong stories are about us: our pride and strength. The FMP project is driven thus.

The Principles 1-7 above have an impact on the FMP Project. Initially, Principle 1-5 seemed the most applicable to my messaging but so too does Audience Platform in the FMP project case around Exhibition versus, book or basically the range of ways of going public.

Mention was made of Fairness and this takes me back to a course I attended on Fairness in the Environment presented by Leeds University. This went into a lot more of the principles of fairness and ran as a two-week course.

Guest Lecture Professor Gary McLeod – Iwate

On the subject of aftermath photography, we were shown current research work around connecting with the tsunami torn areas of Japan. Out of respect, we were asked not to record images.

What resonated here in this fast-moving presentation was mention of spatial and temporal subject matter which resonate with my interest in and around photography.

It is always interesting to see Gary’s visuals from Japan as culturally the signs (semiotics) are vastly different from what is seen in Western cultures.

PHO705: Week 19 Reflection

A model is created for the Exhibition space to experiment with layouts. Here is the first building block to start to work with.

Starting to create the exhibition space in a 3D model (Sketchup Pro)

This is a straightforward adaption of the Summer exhibition which had three of these layouts in a C-shaped floor plan. The adaption is from triptychs to a straight run of 6 mounts of 40cmx50cm mount boards.

Each mount stands on parade or is a metaphor for such.

Ultimately, two other rows will be present making a total of three rows and should run parallel so when the viewer is looking at the front row they would see all of the other rows behind as soldiers on parade. The viewer could process as if conducting a parade inspection.

Okay, so the above 3D model as the start and is an enabler. It has already allowed some ideas to try out as to how to best place the work as befits the intent.

More to follow.

On reflection, the exercise to date has demanded practice be gained in using the 3D IMB layout tool SketchUp Pro. This time is an investment for now and for the future.

Ancillary items to add to the space include the facsimile of the exhibition in a box i.e. the portable exhibition, which stands alongside the main exhibition while it is running. Another item to include is the handbound book.

Within the space there will also be two video screens, an audience seating area and a secondary exhibition of outtakes.

Studio equipment on stands has to be added for the somewhat vital daylight balanced lighting.

Print Handling

The philosophy the author is running with is of not being precious about the prints and in fact encouraging audience interaction. I’ve been normalised to the presence of print handling and during the summer exhibition, I encouraged viewers to interact with a couple of exercises being set out. It created a degree of immersion and sat alongside the other media and sound, creating a suitable atmosphere. Overall this makes a kind of performance.

PHO705: Week 18 Reflection

This blog post reflects on test printing as all of the images made since mid January are made available for an edit. I also reflect on the presentation of work as a facsimile exhibition in box packaging. Finally, there is another look at the Critical Review of Practice for which drafting has fallen behind plan somewhat.

Print

Printing went remarkably well – all 50+ images printed, and are all keepers with no adjustments having been required.

Reflecting further. The prints are quite dark but are subtle in toning and not burnt out in the shadows. It is just that the content has to be discovered under daylight-balanced lighting. This was the same for ghost images at the Summer exhibition and worked as the effect was to draw in the viewer. This is taken as the ideal and fits with intent. The printed work was as envisaged and on-screen and in print. The subject matter by design is somewhat dark thematically as place or landscape as faded memory visualised in the present.

A visit was made to the printers and they allowed their guillotine to be used to cut down 4×6 prints to 4×5 size. This was quick and consistent.

Printshop

The visit to a commercial print shop was also made to enquire about exhibition support items.

  1. Leaflets to promote the exhibition (100-200) as handouts.
  2. Bookbinding three copies of artist books with 64 pages. With embossed/gilded text, front stuff printed and blank pages for the 4×5 glossy prints to be attached. The paper choice wasn’t found to be suitable for my project. A case bound book dummy I’d made earlier has off white paper and makes an excellent surround to the gloss prints. The printer I use offers Black, Light Black, Light light Black and Photo Black. A lot of variation is found in the shadows. This all adds up in the right direction and matches the intent and has been tried and tested.
  3. Packaging for the portable exhibition is in support of the memento style. It is consistent with the commemorative theme.

The previous exhibition was a success as a learning activity even though it was not heavily promoted. Leaflet handouts will address this. Business cards were not available at the time, This was a shame as there opportunities to exchange details. Business cards are available this time branded as turner photo.art. Marketing extends to a new website with consistent email address michael@turnerphoto.art.

All is becoming consistent and should serve the cause beyond the MA Photography course.

Packaging

I’m finding this rather tricky in terms of judgment and I’m currently exploring making. In some areas, it is similar to hand bookbinding and case binding. Why has the time been spent on this? In some respects, the making of an exhibition and the creation of a book somehow overshadow what is potentially the main element of public delivery. It may not be as showy but the author believes the exhibition in a box method best as it extends the conversation about the project and in scale and approach creates better opportunities for others to engage.

In critique, I was advised that it might be advisable to make my own packaging rather than use a commercial test kit box. As noted earlier I have been experimenting with making and ran up against the problem of scale. I’ve been working with a simpler design and large card stock with the hope of being able to run the card through the printer before curing, folding and glueing. So what seems an aside in going public is actually the main preferred approach. If this became the absolute first choice delivery method, it would be necessary to swap from mounted ZINK prints to the preferred glossy prints.

Sketchup 3D designed packaging.

This is very time consuming and extends the demands on skill set to 3D layout software and the practice of making packaging while being at a fairly late stage of FMP. It is is not yet too late but making a box is burning up my time. A question of maintaining balance and acting on the priorities.

As a fallback I have two commercial packaging solutions that meet the original intent, pre-FMP:

4×5 Prints in temporary packaging

Commercial packaging for 2×3 print pairs

Staying with the commercial packaging for a moment and meanwhile creating my own design, I have new packaging shown above for 4×5 prints for edit/critique and a new box for the 2×3 facsimile prints.

This removes the dependency on designing, printing, cutting, folding and glueing which are not central to the delivery of the project in a public setting.

PHO705: Week 17 Reflection

Guest Lecture

This week saw another Guest Lecture take place this time with Paul Clements Photojournalist.

GCC – Module Leader

There was also a Group Guest Critique GCC with the Module Leader and for some reason, probably to do with timing and project evolution the meeting was very much appreciated. A welcome relief.

I was able to announce the intended exhibition visit of a Contemporary Photographic Editor who I am pleased to have volunteered to take a new job with that is waiting until June. This is as a proofreader for a Contemporary Photography Journal. My earlier offer of managing a related ISSUU electronic magazine was something the photographic group couldn’t wait 8 months for and one of my colleagues from a group photographic project took it on. What this says is that the chosen attendee is someone I’d hope to work with.

The course remains the top priority above all else other than the mortal deeds and close relationships. The reason for reflecting on this is to demonstrate to anyone thinking of doing a course such as the Falmouth MA Photography that even at 10-hour study plus 10 hours photographic practice per week, it requires a high level of commitment. My admiration goes to those able to deliver at this level such as is likely of the really talented artist of whom there are many examples on our course. For me, I hail from STEM education and associated career and often worked from a blank sheet of paper through to architected solutions and adapt my experience to the MA.

Making

During the week attention turned to the facsimile / portable exhibition and a small sense of pride resulted from taking printable cardboard and making a dummy box. Printing the guides at A4 resulted in a miniature of only 2’x3′

Pencil marked dummy

An estimated card stock size of between A3 and A2 would be required. The 2″x3″ dimensions are only external for the pictured dummy box. The final box needs to be double the size to accommodate side-by-side mounted miniatures.

Size didn’t matter for the dummy as the intent was to work out the printed surfaces, the orientation of the print surfaces, the glue points and the folding sequence. An overall feel for how sturdy the box would be for the given card stock was also confirmed.

There is the other matter of now the box construction is would be feasible, how is it to be decorated? The theme of own DNA or historic archive? Design decisions need to be made.

Recombinant Rhymes

Recombinant Rhymes was an ArtSci feature on the radio that I’ve adapted to my project to aid context building.

A revisit was made to the literary element of adding contextualising text, specifically a list of dictionary entries for words that contain the base pair letters A, C, G and T.

Perhaps there is scope for extending individual words by concordance perhaps using SketchEngine (SketchEngine, 2020) to expand the text.

On the one hand, this can be categorised as being overly smart which detracts from communication but then again it does allow context to be built and we (I certainly do) know how important context building can be to a visual project especially in the surreal abstract.

Video (and Music)

Music was composed for a Ghost theme feature after a visit to a store that demonstrated the GarageBand music composition software.

A further video has been storyboarded as a follow on to a successful showing at the Summer Exhibition.

Bibliography

SketchEngine (2020) Sketch Engine. Available at: https://app.sketchengine.eu.

PHO705: Week 16 Reflection

Guest Lectures – GLs

Two recent GLs were attended. The first related to online dating and second-hand wedding dresses the second GL looked at life in an eastern European country under what was effectively martial law.

One to One – Critical Review of Practice

There was also a Supervisor session that turned activity on its head in changing direction from project development to one of the main deliverables, the Critical Review of Practice. It mattered not that anticipatory work had begun as nothing of a deliverable standard was yet available. A previous mention was made about having to make a late start this task due to circumstances beyond normal control.

The CRoP task has a dependency on the planned exhibition as that is where the behind the scenes shots are to be obtained and practitioner critical comment received.

The work that was progressed was made to the drumbeat of “No work – no exhibition – no book” etc.

Project Development

A session was conducted to split the overall InDesign file into themes:

  • ghost landscapes
  • ghost images of people
  • narratives of biology around cell division

This is not to mention subdivision into individual Surreal images, and Animals. There are also Ancestral Family Archive images to restore and reprocess as own DNA (base pairs) and glow image.

A lot of this is still in the melting pot as it is a natural development stage as an image set forms, plus there are influences from the book designer session.

There has been some reaching out to practitioners in advance of the Exhibition.

Print is becoming a more imminent activity. A preliminary decision is required over further tests of print making using the matte paper stock.

To create atmosphere, work on a video storyboard was started but somewhat frustratingly dropped, for now, to give precedence to the Critical Review of Practice.

PHO705: Week 15 Reflection

Now that was what is called busy. The connection with the University has re-established big time. There was a gap over November, December and January. To be fair there was the end of year “holiday” and the so-named 3 week assessment period – needed for the other Modules.

Thinking about this in reflection then, several group lectures were attended and there was the follow up from the previous week’s module leader one2one meeting that led to running a consistent aesthetic right across image set.

We also briefly held a peer to peer meeting, the first known of in several months. We’re a small cohort with 10 of 13 starters still around. Only 8 signed up for these meetings. A connection has also been made with a student from another cohort who was passed in my direction by a tutor.

There were also the preparations for a meeting with a book designer Victoria Forrest. All good as the work is interrelated and the key to the public showing. No images, no public showing. The research was toned down and research-led practice had been in full flow again this week.

So how did the book design session go? (rhetorical question). That’s in a separate post.

It was good and has focussed on incorporating one’s own genome. My DNA has been sequenced and has now been downloaded and is being analysed for transcription errors and an academic publication read on the topic. Although specific to kidney disease and with some reference to mice it was nevertheless useful to learn of the error rates, non-base insertion and the weird folding that results. In the mind’s eye the DNA spiral has an idealised representation. This reading gave the truth.

Anyway, the knowledge gives the photographer some deeper information to back up any talk that might follow?

Scanning became a big thing and a whole weekend was spent learning software SilverFast and i1 colour calibration. The reason for this is/was to up the level of professionalism in reusing family archive photographs. The current set I accessed needs to be rescanned. A hidden agenda exists too. The acquisition of a film scanner and darkroom gear means work can go back to film photography. This will now be after the FMP but it is an exciting development in photography. The Studio where I’m based (less so with these studies) is starting to run combined workshops on Landscape and Street film photography. I’m really pleased with this revival.

With so much digital practice and digital darkroom processing, it will be a relief to turn back to film.

Thinking ahead of the week there is the catch-up to be made on Video making and drafting of the Critical Review of Practice CRoP.

Such is the life that this blog post will need to be cut back as some of the activity reported falls into the Week 16 reflection, due in the next day or two.

So, all in all, a very rewarding and active time on the project with work changing rapidly at this point. Lots of connection with the University has been helpful while consuming more of that rare resource called time. Can’t win.

PHO705: Week 14 Reflection

Trial Assignment PDF

Having published a PDF with an extended payload of hi-res photographs last week, in preparation for the one to one meeting with the Module Leader, it was time to keep to plan and size the file. There is a 10MB file limit for the assessment. Success! Over 50 images, which should be over that needed to submit the Assessment PDF and filesize which was whopping has dropped to 5.5MB with no appreciable loss of quality on-screen.

In contemplating the book publication, a second PDF is required and this would need to be produced at high resolution.

There are some known niggles in the content of the following but here is the ‘same’ or equivalent PDF from last time but in its new reduced size. The PDF has been created using industry-leading page layout software Adobe InDesign:

This was an important trial and it has worked. The picture content can be refined as one image went missing during the day and will be tracked down. Three images processed with marginally incorrect height – width was fine.

The experience improved with some practice. Images untreated, or taken as they were at multiple size, needed to be standardised and this took place using Adobe Bridge – Photoshop to run some automation to fix dots per inch and pixel WxH to fit the page and the adjusted 3mm page margins created.

The more work done in preparation the easier it was to manage InDesign. Not just easier, the experience went from impractical to smooth operation.

Some bells and whistles will be added at the next iteration using available image files – many new items are being lined up to go into work, although the exhibition is expected to repeat the 18 number of prints created at a summer run of the exhibition. A greater number of images would be required of a book. The book number will be limited by shadowing standard commercial offerings in view of the potential cost impact in later in taking the hand bound book dummy to a designer.

Returning to the immediate needs, sections have to be added for

  • captions,
  • text (make an appropriate selection fo text),
  • a bibliography,
  • attribution list for images,
  • content page,
  • interactive elements, next/prev buttons, section buttons and so on.

Exhibition Printing

Paper and printing considerations and mounting without frames become necessary to investigate for the charcoal style sepia images with the given light vignette border style. A lesser paper choice last time, was Epson double-sided matte for the handbound book and laser paper for the exhibition guide.

Hahnemuhle art paper has been suggested, whereas until now gloss was chosen for its handling of deep blacks.

Board mounting needs consideration as well as the method of hanging. A professional exhibition stand lined up for the exhibition – not used during the summer, is not recommended at this stage.

It is recommended to print as early as possible to anticipate the time need for adjustments. A first print was made! The available paper stock was Epson double-sided matte, used in making the book for an earlier Ed Ruscha challenge.

There are numerous actions required in the making process to be visited. ISSUU has been revisited as it is used as a means of simulating the book to aid the design, printing and binding. It also makes an electronic version publicly available.

The https://turnerphoto.art website was trialled in the previous module as a commercial selling site and unexpectedly went offline and has since been restored. At present, the marked assessment items take priority over website building and the selling of photographs is something for beyond the course.

These technical matters are always tempting to get involved in but for now, a reasonably good PortfolioBox portfolio site has been maintained and although there are layout limitations each use, there are get around and the company is meant to be quite responsive, although it has not been witnessed personally.

The website had a different purpose earlier in the course, where now, like during the Summer exhibition practice run, it is intended as a support to the exhibition in terms of proving multimedia in promoting it and in generating atmosphere.

In the same vein, social media is being lined up for promoting going public. Instagram has been quiescent for a while ready to roll once the exhibition date is decided (third week of March or first week of April) depending on making more work of publishable standard and whether or not to attend the Falmouth 2020 Face to Face ‘week’.

The outbreak of coronavirus and its spread through international travel could be a risk with this year’s event. A watching brief is being made at present. This is particularly sensitive personally having contracted a bug several times last year in spite of being vaccinated.

Not considered yet is a video recording of an artist talk and the remaking of the moving slides video with better images. An artist talk was run several times during the Summer exhibition.

The making of the portable exhibition in a box continues to be important in moving beyond the studio confines to take the discussion wider to allow it to continue. An unexpected benefit last time was it generated an invitation to attend an art sale. The commercial element whilst welcomed was a little ahead of practice development at that stage.

PHO705: Week 13 Reflection

One to One Preparation (and now for Group Critique)

In preparation for a “one to one” session, a range of portfolio work has been prepared in advance. Beware, if you download the PDF file it is a large size even if already reduced*.

For presentation, it has been decided to screen share in Acrobat page edit mode to give both a visual overview and page by page viewing depending on the zoom setting.

Status is a decision needs to be made to proceed with one theme. of which several are shown.

Probable preference for priority is indicated as

  • sepia landscape & family archive
  • cellular theme
  • abstract with still from newsreel
  • surrealism and other

There is a display of:

  • a scene-setting image of current theme is on page 1
  • sepia ‘Landscape’ prints at the start on pages 2-13
  • a transition from cellular to landscape is at pages 14 and 15
  • the earlier ‘landscape’ style variations are at pages 16-19
  • a venture into the surreal is at various points starting at pages 20-22
  • a family archive crossed with ancestral biology on page 23
  • a theme of ghosts is explored at pages 24-28
  • a non-human variation is on page 29
  • a montage series with newsreel extracted stills begins pages 30-32
  • a lesson learned is on page 33
  • the pan cellular ex cellular series runs over pages 34-40
  • running on to rather surreal examples of work on pages 41-42
  • the cellular continues on pages 43-47
  • the re-use of earlier work is broached at page 47
  • an emergent theme example ‘animal life’ in b&W and colour pages 47-49
  • random elements end the series pages 50-52 with page 52 a caricature

*Learnings at this point prior to the meeting concern the first collection as a PDF and files size being 8x over the allowance. It is the first collection and the solution is to use Adobe InDesign and the save to animated PDF format. This was taught at the university and the subject of an FMP video.

in the transition to professional quality (a lot of the earlier work has been experimental) standardised sizing has been arrived at and needs to be worked retrospectively across the whole image set for display consistency.

PHO705: Assessment Period Reflection

So what has been happing of late?

  • Making new work.
  • Planning going public. (which requires new work)
  • Ramping up the professional
  • Ramping up the quality of work

Overall, an exciting period of practice development.

Concluding, is the intense period of reading and learning putting substance behind research based practice. Going are the days of creating themes in support of project narratives.

For visual language development samples of themes have been created.

  • Father mitochondria layered on mother image (mitochondria as transmitter). Biological markers ready to be layered in next stage.
  • Stills dropped out of newsreel of 100 years ago montaged into project examples
  • Family archive motherline photograph layered with glow image (mitochondria)
  • graphic development of DNA and cellular imagery and text

A rather busy and very worthwhile period indeed.

Three months of work to finish off a professional portfolio of high quality to be taken public Reacquainting with the MA Photography requirements caused a close look at example work created so far.

There were then many ups and downs hinging on the practice of being fully digital in the making. With much time spent in the digital darkroom the methodology was fully re-examined and especially following the digital imaging Symposium at Westminster University.

The Symposium was good and gave access to several key scientists in skincare and medical forensics. For those that know about the project the relevance should be clear. Much was confirmed around the artist’s assumptions of biological science as applied here.

The quality of the work then came under deep scrutiny anticipating cramming a lifework into a meagre 10MB PDF file without undue loss of image quality. The answer is InDesign and the methods documented in the FMP block.

However, any signs of a borderline quality entering the process and the situation will only worsen. Were there signs in current work?

Previous bad experience of transferring to mobile working and lack of connectivity in the Scottish Highlands led to a deliverable quality issue. It was never planned to be like that – the cohort will remember those events.

In an attempt to avoid technical issues deep scrutiny was performed on the work. A solarisation filter is quick to pick up on banding faults and pixelation (not in the original but from processing).

How to resolve this? Some very detailed analysis and comparison trials showed how and where different algorithms broke down affecting an unacceptable number of images.

During the last week of the “break” or so called University Assessment Period, and to which this blog post pertains work continued urgently to sort out technical issues. A number of workshops and external resources were called upon and a growing amount of time was soaked up.

This continued into Week 13. The current blog post is a retrospective. That is how important it was to resolve quality, instigate testing and build a professional approach to practice. Time normally spent learning and researching art and photography began to make way to working the critical methodology during the FMP blocks.

It would be great to have visual examples accompanying this post but for now it is important to continue making and delivering images elsewhere. Return later when priorities resolve.

There has been much catching up to do. After 10 weeks of being slain by the aftereffects of two bouts of flu, it is sad to note the passing of two more family members in the run-up to year-end.

In a way, the losses underline the importance of the project being made complete to pass on to others. The pay-off would be in gathering the technique that others may wish to use with their own, alongside forever unfolding events on a world stage, whether that be a 9/11 or something else.

PHO705: Assessment Period Reflection

The Helter Skelter that is Making (of late)

The research period moved into the making phase within the digital darkroom.

Many up and downswings have been encountered in the making, from renewed optimism to unexpected problems arising that needed to be resolved.

More structured recording of image statuses has now been established on Evernote as a wider body of work has emerged, none of which is entirely satisfactory at present.

Direction around abstract outcomes such as landscapes for some images fell foul of image banding as well as encountering more editing suite false images on the screen versus print.

Being guarded and mindful of this resulted in changes. A solar checking layer is used to detect banding where it might not be immediately visible to the eye followed by a step by step expansion method and 100% viewing (or do and undo merge layers).

And so too, subject matter bias changed in moving to the biology theme with the development of skill in making cellular images alongside associated graphic elements. Maybe too this was an avoidance strategy as avoidance of quality issues which and it led to switching the major theme to and fro ghost/landscape/biology

The methodology has changed through this as methodology currently biases towards forms as Surrealist imagery.

Another branch in the period in between these stages meant conducting a series of trials of merging stills dropped out of newsreel video. That presents challenges with the mixed resolution, edge problems and differential lighting when integrating. Time out was taken to practice overcoming these challenges but as a major wartime theme production has stopped for now. The problems can be tackled with more confidence having gained more practice on different methods. Whether to return to this or not is the question. There are probably too many themes for a book or exhibition and so something has to go. If the biology theme of cellular imagery went ahead then maybe too many similar images result. There is no obvious solution at this stage and so work continues with the numerous themes,

Reading the course requirement for quality scanning and professional making at this level on top of evidencing this does lead towards a situation of panic in these matters.

Thinking through the image merging the experience from the Summer exhibition weighed. Separate archives (of the author in this case) and abstract expressionistic images led to triptych layouts that worked in exhibition but not as a book (the weight of paper in a signature with not enough strength in the stitching. Signatures are complicated, always looking wrong at the earlier printing stage but turn out right, where triptych became unmanageable in the handling and ended up being complex or not practicable as a dummy.

PHO705: Assessment Period Reflection

This reflection is made during the break otherwise timetabled as the first of three weeks of a University assessment period. No work on the Final Major Project FMP module is under assessment at this time. It is simply a break during which work is able to be progressed.

The activities conducted have been:

  • Guest Lectures and
  • Post-processing photographs.

Guest Lectures

The (optional) lectures watched back are:

  • Christiane Monarchi Part 1
  • Christiane Monarchi Part 2
  • David Moore
  • Guy Martin

The guest lecture by Jim Mottram was viewed last year. These lectures have been very useful and represent a blogging task that competes for a limited resource (time) when working on the priority task of making work. It will be necessary for completeness to return and write up the blog posts. It is interesting blogging this point of view when it is still the break.

Post-processing

The methodology employed is to post-process photographs of healing wounds into surreal/abstract style. Subsequent to this is a choice of theme that is essential to building a narrative.

There needs to be an oversupply of candidate images for various outcomes:

  • Exhibition images (for subsequent edit/reduction for the assessment PDF)
  • Book dummy in particular for a group meeting with a Book Designer.

Progress in post-processing

From the outset, time was taken to make the project a research-based project. This has matured and could go on longer than the permitted time for the course but now is coming together as a whole and so making has resumed.

[metaslider id=4045 cssclass=””]

A mixture of figurative images or images with other referents can be seen here. In these images above the referent relates to themes of ghost, inner/outer space, landscape/seascape/mountainscape.

With research ideas in place, making by intuition took take-off once more. As this progressed, that state of flow that is spoken of returned and a variety of outcomes were generated.

Variations sprang forward as in the case of the mind interpreting the outcomes as weird and eerie then finding this feel worked its way into non-healing as you recognise the characteristics in source photographs that likely produce an aesthetic. In particular, there has been an emphasis on synthesising a project theme of inner/outer spaces.

Also, by expanding reading into the Surreal it quickly becomes apparent how geometric manipulations used appropriately can expand the scope of work produced. There is a personal appeal and education bias here. At present, more general acceptance and a decision to proceed will be down to making more geometric manipulations. The purpose is to stimulate structural interest in the original glow images from the trace of healing and life energy.

Module activity has firmly progressed from ArtSci into digital imaging, and from outcomes into how they arise in the conscious mind supported by a reading of the weird and eerie and of the unheimlich and of place.

Another branch being touched upon is a return to further artist research to aid the positioning of practice amongst contemporary photographers.

In the digital post action, it is necessary to limit change if the image becomes overprocessed. For example, banding can occur. In a project that encompasses the real and the imaginary, there is the analogous of realistic depiction and an imaginary version of the image found to be displayed sometimes on screen.

Artefacts first noticed in some processed images in an earlier module returned to haunt a number of edit in FMP. The previous observation was of fringing, now it was of banding.

Eventually, this was traced to image zoom level affecting how the software adapts. The software creates in effect, fleeting visual outcomes that do not exist in reality when saving a file or printing and image. This seemed quite ‘haunting’ until an explanation was found on a technical forum.

The software maker in its attempt to reduce the processing load for a displayed image that is zoomed interpolates the pixel data and injects impermanent changes. Surreal/abstract imagery developed for the FMP Project can be prone to showing the desired finish but it is not possible to save or print.

It is not just the camera that sees differently to the eye, but now the editing software which is deemed an integral part sees differently to the author The camera never lies can be extended to the editor software never lies?

In defence of the software manufacturer, the product is intended for general purpose use within particular specialisms. The type of processing used for the FMP project is susceptible to showing up the problem discussed. It is especially true where there is an openness towards challenging the computing limits.

Integrity checks are now performed on new images during the making. An integrity check would be defined as confirming what is intended is what you see on screen and what you get as a result. We are used to JPEG saves adding artefacts in performing destructive processing when reducing file size. We are already aware of this. It is more of a surprise to see transitional effects that exist completely within the editing software and then vanishes.

If the effect is desirable and needs to be made permanent, then this involves using a camera to photograph the screen. This may or may not be successful by individual image.

Two checks have been routinely incorporated.

First is to add a curves layer with solarisation characteristic. High contrast shows up transitions and identifies banding. Fringing, by comparison, is already directly obvious to the eye.

Curves solar characteristic makes subtle banding more obvious.

Second, as an alternative is to merge layers – the difference is immediately obvious. If editing layers have to be retained then unmerge once the check has been performed.

Finally, try to work at 100% zoom for the true image or switch zoom to check the render. Full zoom at 100%, however, is usually less desirable than fit-to-screen that allows the overall image to be viewed.

Depending on the aesthetic and theme, some forms of banding are referent of DNA testing and so may be desirable in a print.

Reprocessed Photographs

Some photographs taken before FMP have been reprocessed to use more refined techniques that have been developed.

This increases the variety of source material and is consistent with good ethics given the nature of the subject, healing wounds.

More reprocessing is in progress and as the number of outcomes increases a decision can be made.

Narrative

The decision is pending at present around the visual theme. Adding archive to the mix is felt to really strengthen the presentation making it more accessible to the viewer. One processed image has had a second processed image layer added where the still was dropped out of video footage. The combination works well. There is a judgement needed in such pairings and whilst a second paring was found it still remains at present to increase the stock of surreal/abstract images.

[metaslider id=4056 cssclass=””]

PHO705: Christmas Reflection

The last week of Christmas Reflection before the University three week Assessment Period and course resumption next month on 20 January.

Portfolio Image Processing

The intention during the break has been to build a large enough catalogue of images for the current stage – transition to making.

The plan is to generate enough work to feed the planned public outcomes. This building activity is designed to generate the larger numbers of images required and serve to gather feedback and critique prior to a final edit for the assignments.

Work continued on processing images in light of the outcomes following the Imaging Science with the following developments.

Side by side image comparison

This refers to the outcomes of digital darkroom processing before and after imaging science symposium.

This is a side by side comparison of Method A (original image compression/decompression method) versus Method B (filter).

The reason for this was that whilst outcomes were easier to obtain were they flatter as in looking as a greyscale monochrome effect? The results are in the now-classic red developed for the summer exhibition.

Colour Outcomes

With so much focus on the above, the investigation of colour outcomes had taken a minor role in project development in the making aspect and so this has begun to be righted.

[metaslider id=3892 cssclass=””]

Colour Abstract Images by Michael Turner

The use of colour became important and was then dropped during an edit. Primarily, this use of colour became a signature style and appeared to have an indication of having greater commercial potential. What could be better, a signature style with commercial potential? One assessment is that we are living in a political age in which austerity is seen to be coming to a gradual close. Perhaps viewers want something with a sense of bright optimism or perhaps simply a distraction from their day.

The use of colour has to remain true to the project intent and colour was introduced because of this, as a way of remaining independently connected with the past and while living our lives find a sense of celebration.

Would those. making the greatest sacrifice have wished us to live our lives with sombre memory. Recognition, yes, if freely given and more nowadays with a reminder given the decline of living memory. The celebration of freedom is something that does not have to be justified but in doing so celebration represents our natural response to being free.

Celebration ought not to be a constant. Just as a grin tires and even begins to appear foolish we ought to as an intent of the Motherline provide the opportunity for the viewer to look upon the work and be given the opportunity to feel more uplifted. This intent has to be more grounded than consequences otherwise: a heavy heart: or even confusion as to why ponder over that which is dark.

Without consideration, the work could become irrelevant too soon.

There again a mixed visual message could be an outcome of mixing the sombre with the celebratory. It could easily make resolved work look unresolved.

To date, the use of colour has stubbornly remained as monochrome plus red (as in the blood spilt). The bright vibrant colours were dropped. However, it is a strong sign that colour was never let go of completely meaning that is an important element for the author.

It is not necessary or always beneficial to have a fixed signature style and yet realising this, it is a stronger motive to have vibrant saturated colour as an uplifting portfolio intent but that has to remain rooted to the past.

A previous line of the study led to Art as an Experience as a way forward but with a final outcome or realisation that Rothko who created work in this style ended his own life. This created a flash response, a rejection of this kind of art due to the association of an act seen as cowardly in some senses and it is linked to themes of bravery. This seemed like a form of ‘contamination’. The wrong word but a countertheme perhaps.

There is also the important consideration of self-preservation when deeply involved in the emotional response to the past events that consumed relatives. Normally, there would be moments of feeling but as an ongoing photography project, the intensity of feeling was heightened time and again through the authorship task. In a sense, this turned the theme away from colour but the themes remained in sombre mood. Something has changed in the six months or so that have passed.

It has to be the taking up again of Family Constellations. Realising that they (ancestors) had their lives, and lived the consequences, there is no need for us (or the author) to allow ourselves to become consumed. We can avoid entanglement with those we loved or would have loved and realise that we can simply live our own lives to the best we can reasonably do so.

What does this mean? Simply that the seeming barrier to using bright vibrant and saturated colour can be removed and colour brought back.

Looking back, is this the whole story? Two modules ago a colour image went for critique and was deemed undeniably to be DECORATIVE. The colour palette was pastel in the image, and not in harmony with the sombre.

Around this time Art as Experience as in Rothko’s large scale paintings in colour fell from favour in learning of Rothko’s demise. Circumstances further combined around the quasi-spiritual way in which an element of randomness in image data, resulted in stronger black and white images tied to emergent themes (of biology and of ghosts). And in such ways the argument swings between colour and black and white.

There is an element of being guided by the quasi-spiritual as this links to the soul of the author. This can be an intense experience. Whether this translates to the viewer is another matter.

What did connect at the practice exhibition was the availability of contextualising material and an artist talk. Beyond this was a strong engagement with activity in the presence of the author. Being able to pick up the prints and the exhibition in a box that was present meant visitors engaged over these. Whether this would stand in the absence of the author is probably a key point. Is the work meant to be a performance, is a key question? In fact, performance is the natural element the author prefers to work with as the socialising element of photography is a key motivator.

As an exhibition, this can be managed and through the author’s nature, it would be difficult to resist engagement. Again though, how would the work stand in the author’s absence. There are more occasions possible without the presence of the author, thus it becomes necessary to convey somehow that presence by some other means such as recording and prepared materials (for exhibition activity).

The strongest implementation is the exhibition in a box as it encompasses many if not all of the characteristics thought desireable. The presentation of the exhibition in a box at critique at Unseen Amsterdam was the embodiment. The way that critique ran, was as a result of having had the practice exhibition as a primer.

Public outreach becomes the challenge, So although the performative elements are satisfied would there be little or no residual message for the public, a curator or compared to prize entry.

A book, and it was thought that a book would be a strong approach, could resolve some of the performative and outreach elements. It would have to be more than a picture book and border on an activity book.

At the summer exhibition, it was good to have a book dummy to show the scope of the course, over which there was interest. This time it would be necessary to contain the subject to the Motherline project, where before it was the outcome of the so-called Rothko challenge.

An exhibition pamphlet was also created and was dark printed. Even the red colour was printed in black. This was a very uniform pamphlet in the current trend of the black paper noted at Arles Recontres. It was simple, lightweight in production demands (other than ink) and carried off well in dark mood. The actual pamphlet contained the full 23 image selection rather than the slightly later 18 image edit of the final exhibition. There was also a solution to cover printing.

Another pamphlet has to be made. This is in the final project plan. It could carry off colour printing but perhaps not with the same consistency as the black and white pamphlet. There is an accomplishment in hand binding even for the saddle-stitched example.

After a recent visit to The Photographers Gallery examples were purchased of sheet books similar to the pamphlet. One is unstitched and a plastic cover (Klien, 2019) with a long edge fold to keep the sheets stacked. The other is a small-sized monograph (Atkinson, 2017) with stapled binding.

Also in the portrayal of molecular biology, visuals e.g. DNA authors use colour for visual elements as an artistic choice. Vibrant, saturated colour fits well with this established theme.

Further Image Development

Image abstractions had so far resulted from healing wound photographs as this is the powerful tie between the living and those ancestors from the past. In the current period of reflection, the reading around the Unheimlich or Phantasmagoria, the Weird and the Eerie has had an impact on visual perception. Once triggered the appearance of abstract ghost or landscapes became unavoidable. As a consequence not 100% of abstract ghost images or eerie landscapes have been derived from healing wounds.

Once the mind’s eye became attuned, a few potential photographs began to be gathered and processed. Although only a few such images have resulted, the principle of authenticity has to be considered. Would these images pollute, or even dilute the work? Perhaps it is no different to using archive photographs?

FMP Guest Lectures

It was decided early on to engage in the (optional) guest lecture series provided as FMP resources. Ahead of deadline which if there is one is during resumption in late January.

In looking ahead the following lectures have been watched ahead of updating a blog post for each.


Guest Lecture (Publication) – Christiane Monarchi Part 1

Guest Lecture (Publication) – Christiane Monarchi Part 2

Guest Lecture (Publication) – Jim Mortram

Guest Lecture (Publication) – David Moore

Guest Lecture (Publication) – Guy Martin

Work is being piled up in the break. It will be important to keep the balance of progress right. As a consequence, Guest Lecture consumption has been placed outside of “office hours”. Watching the GLs encourages focus on them and while it would be good to complete the related blog posts this would detract from other key activities.

A video/moving still has yet to be made. The approaches considered for making have two options at present 1) a moving landscape – a file has been processed to enable this to be done. 2) a remake of the video made in the previous module and used in the Summer Exhibition – the materials could bring onboard archive stills, the historic family album and war scene images extracted from video footage.

This serves to expand the related theme possibilities and has been an investment in time. It may be that the time has arrived to begin looking for the most plausible way forward that strengthens the project Motherline.

The examples of other work that comes to mind when resolving this are:

War Primer 2 (Broomberg, 2018) – here pages are media collages of different sources of still including from television or video in one example a tv broadcast is visible. This is the most comprehensive use of materials but likely a challenge to manage as a solo presentation. Is it necessary to use all of the sources gathered for the FMP Module,? Probably no, if the result looks scruffy and the public materials have increased scope of errant decision making by incorrectly pairing when there is a vast amount of images not to mention the appearance of several texts per collage. Broomberg worked with Chanarin and so together they were able to take stock and check more readily for potential flaws. It is not known how long the authors spent creating the edit for War Primer 2 but this could easily exceed the FMP three months work remaining on this MA Photography course.

What is most likely is that War Primer 2 provides a structure to test against in making Motherline. Then beyond the MA there are materials already researched for potential further development. One possibility is to separate some of the picture sources into supporting work products, as in an extra book dummy which could be useful in further practising bookbinding. or as a video or moving still resource.

It will be advisable to avoid being drawn into this too far before considering the mark. In the previous module, in addition to the three assignments that were handed in, a lot of hard work was done and at the last, there were unmarked items: book dummies (book and catalogue), an eight-day (so-called practice) exhibition with an artist talk and other supporting work; portable exhibition in a box, video, music selection, side exhibition of colour abstract work and extra prints.

Reminders

Trial PDF making.

Return to video / moving stills making.

Bibliography

Atkinson, C. (2017) London Barbican. 2017 Open. Cafe Royal Books CRB. Available at: www.caferoyalbooks.com.

Broomberg, A. and Chanarin, O. (2018) War Primer 2. London, [England]: MACK.

Klein, W. (2019) Photographique. 1st edn. Edited by K. Stevens and P.-L. Denis. ethos.ink. Available at: http://www.ethos.ink.

PHO705: Christmas Reflection

This post relates to calendar Weeks 13 and 14. A return was made to reading, PHO705: Research – Phantasmagoria and the Weird and the Eerie in PHO705: Beyond the Unheimlich. This has meant going back to these earlier weeks posts to update them.

The way this blog is structured it keeps to an original plan of delivering posts to a given schedule. A number of blank posts are present that call for attention, for example, reviewing some optional FMP video materials that if reviewed give a wider experience. This brings attention to the activities and should help to get the work done. There is a natural balance developing.

At present activity has been prioritised towards making and this is timely given the Symposium attended and the access gained to relevant expertise and further related research. Meanwhile, sets of images will be needed as a growing matter of urgency, to build a broad portfolio for onward editing. Making also gained importance in avoiding any pitfall in interpreting science. An example that comes to mind is that of Phrenology from the earlier years of photography. The project assumption around IR filtering and processing becomes trace rather than direct as originally postulated. The theme of identification of Motherline ancestors remained true.

PHO705: Digital Darkroom Analysis for Motherline

An analysis of digital darkroom activity followed on from the posts on Art Science and Imaging Science Symposium and concerns the How. This has resulted on a return to making which until now had slowed while research ran on.

A change in method has occurred to an equivalent approach that produces equivalent results and was possible after a more detailed look into the techniques used as well as having been able to enter the discussion with scientific imaging experts. The new darkroom method is more direct and controllable and simpler to work with.

Greater insight has led to more flexible image manipulation and then onto a new approach able to generate image sets. Potentially the extended method could be used to generate wide landscapes or sets of images for moving stills. This is very much in tune with the Final Proposal to generate supporting materials during the seasonal break, to advance the materials available to use in an exhibition or book.

Further work into contextualising the project visuals has been progressed by capturing images from Great War video broadcast material. The capture and initial handling of the numerous images is an enabler to any next stage.

The themes derived have expanded choice and at some point in the next month say some decisions will have to be made. It would make sense to trial the themes where possible and even make them public to get a sense of what gains the best impact while maintaining the original project intent.

PHO705: Recombinant Rhymes and DNA Art

This blog was revisited and research extended from DNA to RNA and the 1100-word set for words containing the letters ACGT of the DNA bases has been extended for RNA bases ACGU with a 500-word set (lists partially overlap each other). It has been informative to learn of the RNA processes and how it connects to the overall picture of life.

The activity is more of a supporting task than the main task of the FMP but will add to the overall impact of the planned exhibition and possibly of a book.

Conclusion

First identified in PHO705: Research-Driven Practice effort has substantially moved to build research around Motherline project development. The natural cycle of research turning into making continues on from two earlier modules and informs the FMP module activity which is given a solid grounding in project-related research. The intent is to take work public and then enter a final stage of refinement and edit stage to ready for submission for assessment.

PHO705: Guest Lecture (Publication) – Christiane Monarchi Part 2

Watch this Guest Lecture video and comment.

This is a lecture designed to help artists/photographers take their work forward and is based on experience in the art market and photography competitions.

The idea is to think of the product and object product quality. Lower quality can be of greater value. Long-lasting ink helps as does a small edition size where 3 might be better than 20 is unique. Start with low prices and grow with later editions after sell out.

Consider mounting so collectors can store as archival photographs and longevity affects price.

Another consideration is to prepare a statement for later to be condensed. Have own words ready to go.

It’s better to have updates on the website rather than separate CV. It is valid to have an interchange say with other students and record their interpretation of work. It is very different to only the artist’s own words and less emotional and personal.

Social media should be about you and promote others exhibitions. Link back to the website.

[metaslider id=4124 cssclass=””]

Advice from an RA talk was given. Then different types of gallery were classified.

In another part of the guest lecture consideration and advice was given over Competitions (and residencies) and of Collectives where people foster creativity and show together.

PHO705: Week 12 Reflection

The following were covered in Week 12/;

PHO705: Symposium – Good Picture 2019 “Imaging Revealed”

The Symposium was long-awaited (August – December), and in terms of the ‘How’ element of the major project Motherline. The impact of ancestral identification was tested in discussion with imaging science professionals. Fortunately, the basis of the project once more stands when the premise is tested against science.

The input received on the methodology of making acted as a precursor for ramping up image creation which during the break has now taken off.

PHO705: Recombinant Rhymes and DNA Art

Recombinant rhymes and DNA Art is approached as supporting art either in creating Exhibition context or as part of a book, or indeed both.

The scope was set as words containing DNA base letters ACGT from which ‘poetry’ might be created. Originally this was inspired ‘double-strand poetry’ from a BBC Art-Science podcast.

Since the word list (circa 1100 words) was created for DNA using ACGT bases a second and partly overlapping wordlist (circa 500 words) has been created for RNA using its bases ACGU.

The idea would be to create a spoken-word recording and contextualising graphics for exhibition atmosphere and book in turn.

The atmospherics of playing spoken word was experienced at the Tate Modern exhibition of Natalia Goncharova’s work. In one area, viewers were funnelled through a corridor space that linked two functional areas. The corridor had its own smaller-scale works on view. Playing in the background was a recording of a Russian speaker whose voice created a wonderful aesthetic effect.

Example Russian speaker recording from the Tate exhibition:

During the summer exhibition. the atmosphere was created by video (and for a while using audio) and proved effective as a trial.

PHO705: Group Guest Critique 10 Dec 2019

There were two students with our guest so a minimum group size on the day.

The other student went first whose work had already been reviewed amongst the cohort. Comment related to:

  • advice to drop text and focus on visual language.
  • a question about reverting to film process.

The recently named Motherline was reviewed and received reviewer comment. Questions related to clarification and comments were mainly of the checklist variety:

Was the intent exhibition? Yes. The summer exhibition led to a question about the level of comment received. This was recorded already within this blog. The reviewer wished to attend the Easter exhibition as the venue had been decided and dates needed to be pencilled in.

PHO705: Guest Lecture (Publication) – Christiane Monarchi Part 1

Watch this Guest Lecture video and comment.

Christiane set-up Photomonitor and explained how this was set-up from her getting involved in Pluck and Portfolio and a desire to find out what was on. across a range of areas over and above the large institutions. She would advise in how to set up a niche.

Gaps were found in the offerings of:

  • Art List – large institutions
  • Art Rabbit.com – global and no UK focus
  • New Exhibitions Guide – major mostly historic items
  • British Journal of Photography – stopped doing listings
  • Photoworks – annual, great read but infrequent

Christiane’s requirement was UK and Ireland centric, for artists and emerging writers and all in an up to date guide of what’s on now. Here need was to bring people to photography and go and see it, think about it and spread the word. All without ads and is free.

The result in 2011 was www.photomonitor.co.uk. From the front page, key links are the Portfolio link written by the artist rather than mediated, there are listings sometimes with reading more depending on the gallery and their subscription. There are Reviews including of live exhibitions. Interviews talking to artists. Essays that have been researched. Auctions cover smaller upcoming auctions. Collections are interviews. Book reviews cover self-published and large publishers.

Christiane encourages artists to take a break and listen to others.

In terms of making a publication the 5 Years’ statistics were given:

The right hand column draws funding and that pays for commissioning the items on the right as community members.

In summary there are many many opportunities to see work that is shared.

Commissioned pieces are paid at 20p a word to a maximum as a budget constraint. 500 words on a screen are practical.

Commissioning is wider than London covering Wales and Ireland. Timeliness is key as mentioned to get people to the exhibitions. Social media is important for sharing.

t: @photomonitor

Christiane talked about potential for growing Photomonitor including into streaming of live audience talks.

Some Inspiring Platforms were listed:

Anyone with new ideas is encouraged to get in contact.

Response to Online Publication.

It is always exciting to see the smaller business venture establish itself and succeed. Any personal involvement would be to read Photomonitor and assess how it stands alongside say for example, major gallery memberships.

The online element is approached as a Portfolio website and as Instagram for marketing (planned) not to mention this blog site created for the MA Photography course.

There is still more to discover in Part 2 of Christiane’s guest lecture.

PHO705: Week 11 Reflection

As research continues into Phenomenology and mtDNA thoughts cast ahead to publication – PHO705: THINKING ALLOWED/ALOUD. In a sense, this has been a reflection upon recent refections and keeps in mind the need to take the work public.

The blog post PHO705: Artist Jake Wood Evans led to quite a bit of inspiration over colour. Colour has previously been worked on where it settled. In other words, the colour palette settled on monochrome and red as the preferred colour scheme. The reason for mentioning this is that whilst the references are very useful and interesting, the value of making a deeper dive could have limited value other than polishing work as there is already a developed sense of colour from work practice and ongoing development of colour in the projects developed for this MA Photography course.

While PHO705: Thinking allowed/aloud cast ahead to possibilities for making. This made a break from the intensity of research themes; of Phenomenology and the biological in terms of mtDNA.

In the background, research into Phenomenology in relation to the final photo project continued in spare moments. This will need to be taken under closer control to prevent reading from becoming too open-ended.

It is beginning to be sensed how much more time needs to be spent researching topics that can become very open-ended. IT has been quite a luxury being able to spend the time so far and this has aligned with such matters as continually being laid dreadfully low as bug resistance seemed to almost disappear for the majority of the Final module.

Whilst reflecting on colour, a seminal work was re-discovered that is available in PDf form. (Itten, 1970)

Bibliography

Itten, J. (1970) The Elements of Color. Edited by F. Birren and E. van Hagen. New York, Cincinnati, Toronto, London, Melbourne: Van Nostrand Reinhold Company. Available at: https://monoskop.org/images/4/46/Itten_Johannes_The_Elements_of_Color.pdf.

PHO705: Guest Lecture Alex Bailey

The video can be found here.

Alex is a Commercial Photographer working over several decades on marketing and publicity for film and television.

He described how this work is delineated and gave examples of commissioned work, a concept sheet and a mood board.

As we as students have learned to do, Alex for the first time was faced with making a presentation of; his own influences; what brought him to photography and which book and photographic names encouraged him to become a Commercial photographer, one who brings his own artistic integrity.

Key aspects of career had been: the opening up of the closed shop practices that existed prior to the Thatcher political era, and the impact of the transition to digital on technical and business practice.

The practicalities of commercial practice were illuminated. The passion Alex has for his subject is clear.

Personally, what was said resonated clearly with some fairly recent education on the film industry. This industry is active in the local region around London.

Copious notes were taken. I shan’t dwell on this lecture even though it was thoroughly enjoyed as a contrasting practice to my own. Seeing Alex’s work and getting such insight into his contrasting practice was a great help in understanding my own practice.

PHO705: Week 10 Reflection

Week 10 completed whilst still getting over the after-effects of flu.

Another research week (with some photographs post-processed).

Research into Biology has somewhat taken priority.

Reading continues with Photography and the Optical Unconscious (Smith, 2017).

There remains a backlog of reading material with Phantasmagoria (Warner, 2006); The Weird and the Eerie (Fisher, 2016), Memory of Place (Trigg, 2013); the Body Keeps the Score (Kolk, 2015).

Competition between themes meant a switch for Phenomenology to mtDNA. Time did need to be spent on visual research of mtDNA. There is a need to switch back to the Phenomenological in Week 11.

There is a growing need to further develop photographs in the digital darkroom if work is to be shown. The last update was in PHO705: Week 9 Reflection.

Bibliography

Miller, A. I. (2014) Colliding Worlds – How Cutting-Edge Science is Redefining Contemporary Art. New York and London: W. W. Norton and Company. Available at: http://www.wwnorton.

Smith, S. M. and Sliwinski, S. (2017) Photography and the Optical Unconscious. eBook. Chicago, US: Duke University Press. Available at: https://lccn.loc.gov/2016048393.

Backlog

Fisher, M. (2016) The Weird and the Eerie. London, [England]: Repeater Books. Available at: https://www.repeaterbooks.com.

Kolk, B. Van Der (2015) The Body Keeps the Score Mind, Brain and Body in the Transformation of Trauma. Penguin. Great Britain: Penguin Random House UK. Available at: http://www.greenpenguin.co.uk.

Trigg, D. (2013) The Memory of Place A Phenomenology of the Uncanny. Athens: Ohio University Press. Available at: http://www.ohioswallow.com.

Warner, M. (2006) Phantasmagoria Spirit Visions, Metaphors and Media into the Twenty-first Century. Oxford, United Kingdom: Oxford University Press.

PHO705: Research – more on the Unheimlich

General

Having recently communicated progress and details of research themes for the Major Project, the action has triggered several responses in terms of recommended reads, both from a Supervisor and here a Tutor from a Guest Group Critique.

Recommendations made were an essay (Middleton, 2005), a White Cube Diaries (Anderson, 2013) publication with visual examples of the uncanny. Finally, Photography and the Optical Unconscious. (Smith, 2017)

Photography and the Optical Unconcious

Return to blog here once the reference has been read.

Revenant 1 by Michael Turner

Photography and the Uncanny

In the essay/thesis Photography and the Uncanny (Middleton, 2005), acute observations are made regarding photography as seen through a lens of psychoanalysis. This references Barthes and in the semiotic a mix of symbolic and imaginary then the presence of Death in the photograph.

The photo-project though has a different emphasis being based on a theme of healing, mitochondrial DNA as an information carrier and a collapse of time that enables identification with ancestors. There is an element of the Double of those who are contemporary and those who existed in the past.

The essay considered specific photographs in an endeavour to seek out the uncanny but turned to the theory of photography instead. (ibid)

In the photo project, the abstract process is consistent in creating uncanny outcomes. Randomness exists as intuition barely provided direction of the likely outcome although with practice the source images begin to yield clues. The practice of abstraction allows work to continue on an image until an outcome or outcomes become certain. In other words, like a search for the uncanny, the work can continue until the mind’s eye detects an endpoint categorisation of interest.

Consideration is given to aesthetics and the return of the repressed in an unfamiliar guise (ibid). Certainly, for the photo project, the outcomes or images derived from abstraction are recognised when being created. There is a sense of loss to which ghost images easily connect. As a place, there are types of terrain that attribute easily to the past home, to the coastal areas and sea and the presence of mountains. Finally, the emergence of inner spaces and outer spaces with similar aesthetics relate well to the theme of microbiology. In conclusion, thus far, there is a crossover as well as substantial differences. The key is most likely easier as the attribution of the abstracted images to painting more than to photography even if the data captured is done so through photography.

There may well be a connection to the unconscious and the drives (ibid) However, the effect sought is not revulsion but more of the weighty personal experience and the joy of healing and the identification that it now brings.

The return of the familiar (ibid) is a fascinating concept as identification in the photo project is with those who were lost who ought to have been known and it is the impact of this loss on those who existed within living memory and of the places that were once a shared homeland. There is though the presence of an obscured element (ibid). Indeed the photographs taken for the project do offer (although the possibility of) the unfamiliar and novel perspective of reality (ibid), even if this is not a rigorous definition of the uncanny in photography.

What is written about Photography and the Uncanny (ibid) holds true for the photo project. The uncanny is a latent presence in photography (ibid) and not all photographs are uncanny yet the medium embodies the criteria necessary to construct it as uncanny (ibid), This may well ally to the idea of the abstraction process being akin to painting which certainly has the required elements of making as relating to the above “necessary to construct”.

The lifeless object as animate (ibid) can be seen to parallel the photo project. in which there is a glow representation of warmth and health and life attached to the otherwise Dead photograph even when of a live subject making connections to the Dead though spectres or visions of the past.

Again there is correspondence in the mechanical eye being able in some ways to usurp the supremacy of the eye (ibid). The photo project relies on the digital sensor capturing data not readily apparent to the eye until processed (enhanced) during a post-processing phase.

In terms of Freud and the fateful (ibid), there is no decisive moment although perhaps there is a decisive era in which to act before all living memory of a certain past is forever lost. As such the photographic practice needs to be performed as there is a sense that this is a life’s work or indeed one’s fate.

The uncanny imagery created through practice does have a likeness to the photographer having an unconscious knowledge that intuitively (ibid) an image could be made and may do so with the presence of the calculated chance.

The photo project has a sense of the double, the person in the contemporary being linked by identical mitochondrial DNA to the person discovered in the past. When the “double” is symbolically viewed as “the uncanny harbinger of death” (ibid) then this must raise serious concern. In a sense, there is a harbinger effect. By not completing this life’s work, the spectre of found ancestors will finally be lost. Also, the photograph becomes not so much what it is a picture of, but what it can represent (ibid), indeed by the abstract post process.

“Photography, therefore, appears to distort concepts of reality and time, the photograph being both an instance of (stopped) time, the past, existing within the continuum of the present, and the conflation of the past and the present can produce an unnerving effect.” (ibid). This effect is experienced in the photo project but rather than unnerving there is another emotional response considered thus far as identification with ancestors.

What is clear is that when the personal element is removed a template should be possible to create for others to use in their own particular circumstances. If an example was constructed it could be the unborn child, on growing up identifying say with a parent who perished in an event such as 9/11. Any other catastrophic event on a world stage ought to create possibilities for the adoption of the technique.

“the photograph of the missing being, as Sontag says, will touch me like the delayed rays of a star.” quoted in (ibid) This nicely equates to the photo project, of the missing persons discovered, and of the inner/outer space depictions that appear in some of the abstracted images.

Also, the comment (ibid) “The nature of the medium as an indexical imprint of the object means that any photographed object or person has a ghostly presence53, an uncanniness that might be likened to the return of the dead”

In the photo project, the photo is of a living person who identifies with the ghostly presence of the ancestor. As for the tension of the implicit and lack of explicit (ibid) the photo project can appear more didactic than this as a ghost appears as a ghost image. In that sense a figurative image from the abstract. That much is unresolved in the photo project.

The White Cube Diaries

The Uncanny has been described as something simultaneously familiar and foreign. (Anderson, 2013) A product of intellectual uncertainty Jentsch quoted in (ibid).

In Freudian terms, Unheimlich represents everything that was intended to remain secret that has come out into the open (ibid). There is more than one interpretation to be found in the references here and elsewhere.

When we encounter these things there is provoked a suppressed primordial fear, resulting in intellectual uncertainty and causes a great sense of repulsion and distress. (ibid)

While objects so designed create distress and repulsion, they may lead to fascination and allure, (ibid)

Bibliography

Anderson, L. (2013) The Uncanny: where psychology meets artThe White Cube Diaries. Available at: https://whitecubediaries.wordpress.com/2013/02/21/the-uncanny-where-psychology-meets-art/ .

Middleton, N. (2005) Photography and the Uncanny. Available at: http://www.nicholasmiddleton.co.uk/thesis/thesis3.html .

Smith, S. M. and Sliwinski, S. (2017) Photography and the Optical Unconcious. eBook. Chicago, US: Duke University Press. Available at: https://lccn.loc.gov/2016048393.