To me the course “Digital Photography: Discover your Genre and Develop your Style” is at variance with Conceptual Art Photography.

Research

At Annex A, the proposed method of developing photographic practice for a conceptual art photographer seems comprehensive, covering a range of photography genres. However, there are several areas where it could potentially be improved and refined to better align with the needs of a conceptual art photographer.

1. Conceptual Focus: The focus on ‘Things’, ‘People and events’, and ‘Environment’ is too broad and could be more concept-driven given the audience is conceptual art photographers. It’s worth noting that conceptual art photography isn’t about the subject per se, but about the concept or idea behind the artwork. It could be more beneficial to focus on exploring themes, symbols, narrative structures, and the theoretical underpinnings of conceptual art.
2. Abstract Elements: The plan seems to lack the mention of abstract or non-literal photographic techniques. For a conceptual photographer, the ability to create and manipulate abstract elements in photos is essential. This can include techniques such as multiple exposures, motion blur, use of lights and shadows, color theory, and digital post-processing techniques.
3. Critical Theory and Context: It’s crucial to understand the wider context and critical theory that surround conceptual art. For example, the understanding of semiotics, the study of signs and symbols, is paramount in conceptual photography. The plan should include elements of art history, philosophy, and cultural studies to provide a deeper understanding of the context in which the photographer is working.
4. Storytelling and Concept Development: There seems to be no explicit mention of developing storytelling skills or learning to create and develop concepts. Conceptual photography often has a strong narrative or idea behind it. Developing skills in conceptualizing ideas and turning them into compelling visual narratives should be a part of the plan.
5. Review and Critique: A key aspect of developing as a photographer is receiving feedback on your work. Incorporating peer reviews, critiques, and discussions can help photographers learn from each other’s strengths and weaknesses.
6. The Business Side of Photography: The practical business side of photography seems missing. Topics like copyright, marketing, selling art works, or developing a portfolio and online presence would be beneficial for aspiring professional photographers.

To summarise, while the current plan provides a broad base of genres, for a conceptual art photographer it might be more beneficial to focus less on the specifics of each genre and more on developing skills in concept creation, storytelling, abstract elements, critical theory, and professional practices.

As for Critical Theory I expand on this a bit more:

Critical theory in the context of art and photography refers to a range of theoretical and philosophical perspectives that seek to understand, interpret, and critique art and culture. Here are some of the key aspects of critical theory for the conceptual art photographer:

1. Semiotics: This is the study of signs and symbols and their use or interpretation. In photography, semiotics can be used to analyze and create images that communicate specific ideas or concepts.
2. Postmodernism: This theory criticizes modernist ideals and encourages questioning of grand narratives and ideologies. It often involves the deconstruction and analysis of images, exploring how they reflect or subvert cultural norms and power structures.
3. Psychoanalysis: Concepts from psychoanalysis, such as those developed by Sigmund Freud and Jacques Lacan, can be used to explore themes of identity, desire, and the unconscious in art.
4. Feminist Theory: This theory examines gender inequality and the social and political structures that perpetuate it. In the context of art, it might involve critiquing the male gaze or exploring the representation of women and gender roles.
5. Marxist Theory: This theory involves the critique of capitalism and the exploration of class structures and struggle. In art, it might involve a critical analysis of the art market or the commodification of art and images.
6. Post-colonial Theory: This theoretical perspective deals with the effects of colonization on cultures and societies. In art and photography, it might involve exploring themes of identity, race, and power dynamics.
7. Queer Theory: Queer theory focuses on sexuality, challenging the heteronormative structures of society. In art, this could mean exploring non-normative sexualities and genders, and challenging traditional representations.

Incorporating these theories into the study of photography can provide a deep understanding of how images are created, interpreted, and received. They can offer valuable tools for conceptual art photographers who wish to create thoughtful and challenging work.

General

The Open University (OU) course is similar to and supersedes other online course materials, TZFM200 in particular. The described approach simplifies the topic of genre selection and style development. This presumably allows the photographer who is growing in confidence to connect which you might think is good. However, the 10 weeks is spread over the busy summer holiday period which can be a logistical challenge. But then it is not so easy to complete the course by the time the assessment comes around, That is unless one is super clear about creating a statement of intent (SOI) and following it through while doing a substantial edit that leads to 12 really good photographs that fit the SOI brief.

Annexe A

Here is the marketing information from a new Open University course delivered by FutureLearn in partnership with the RPS:

_{https://www.futurelearn.com/microcredentials/digital-photography-discover-your-genre?utm_source=Iterable&utm_medium=email&utm_campaign=fl_marketing&utm_term=230627_MIC_TAR_EXTENDED}

Digital Photography: Discover your Genre and Develop your Style

“Michael Turner CRJ,” is a platform where I share my journey and experiences in the world of photography and visual arts. I discuss various topics related to photography, including different techniques, reflections on my work, and reviews of other photographers’ work.

In my blog, you’ll find different sections:

1. MA in Photography: Here, I share my experiences as I pursue a Master of Arts degree in Photography. I reflect on my coursework, discuss my assignments, and share my thoughts on the overall learning experience.
2. Photographers: In this section, I review and discuss the work of various photographers. I reflect on the techniques they use and how their work influences my own photography.
3. Techniques: This is where I discuss various photographic techniques. I share my experiences in trying out these techniques and reflect on their effectiveness.
4. Reflections: Here, I reflect on my own work. I discuss my thought process in creating my photographs, the challenges I face, and the lessons I learn.
5. Research & Reading: In this section, I discuss various research materials and readings related to photography. I reflect on books, articles, and other resources that I find helpful in my study of photography.

I regularly update my blog with new posts and encourage interaction through comments.

Combining photography with computing can lead to some exciting and innovative visual experiences. One way to achieve this is through the use of Processing, a programming language that allows for the creation of dynamic and interactive visuals. As part of my FMP research, I have been considering the use of Processing in connection with my photography, specifically around the topic of mitochondrial DNA (mtDNA).

Mitochondrial DNA is a type of DNA that is found in the mitochondria of cells and is passed down maternally. This type of DNA can be used to trace ancestry and is also important in understanding genetic diseases. By combining photography with dynamic visualizations of mtDNA, I hope to create a unique and engaging experience for viewers.

To achieve this, I plan to add a layer of computed visuals to my photography using Processing. One possible approach could be to create an animated representation of mtDNA that responds to user input, allowing viewers to interact with the visualizations in real-time.

In addition to using computed visuals, I also plan to incorporate animated teeth as a narrator in my project. To accomplish this, I will be reusing code from an earlier course on Processing. The code for the animation is shown below:

float toothY = 0;
float toothDir = 1;

void setup() {
size(400, 400);
noStroke();
fill(255);
frameRate(45);
}

void draw() {
background(0);

// Update the tooth position
toothY += toothDir * 5;
if (toothY < -30 || toothY > 30) {
toothDir = -toothDir;
}

// Draw the teeth
pushMatrix();
translate(width/2, height/2 – 60 + toothY);
scale(0.5);
drawTooth(-80, -20, 30, 60);
drawTooth(-40, -10, 20, 50);
drawTooth(0, 0, 20, 40);
drawTooth(40, -10, 20, 50);
drawTooth(80, -20, 30, 60);
popMatrix();

pushMatrix();
translate(width/2, height/2 + 60 – toothY);
scale(0.5);
drawTooth(-70, 10, 20, 40);
drawTooth(-30, 20, 20, 50);
drawTooth(10, 20, 20, 50);
drawTooth(50, 10, 20, 40);
popMatrix();
}

void drawTooth(float x, float y, float w, float h) {
beginShape();
vertex(x-w/2, y);
bezierVertex(x-w/2, y-h, x+w/2, y-h, x+w/2, y);
vertex(x+w/2-w/5, y);
vertex(x+w/2-w/5, y-h/2);
vertex(x+w/5, y-h/2);
vertex(x+w/5, y);
endShape(CLOSE);
}

This code creates a simple animation of 10 teeth that move across the screen from left to right. To run this animation on Mac OS, you will need to download Processing version 4 from the Processing.org website. Once downloaded, simply copy and paste the code into a new sketch and click the “play” button to run the animation.

Mitochondrial DNA Example Sequence

While my own DNA has been decoded, I cannot share the actual coding due to privacy concerns. However, I have used a mitochondrial DNA sequence as an example in a photograph of my paternal grandmother, as part of a project to trace my father’s ancestry. I plan to create similar visualizations using antique photographs of my maternal grandmother and great-grandmother from my family photo collection.

GTGCTGATCACAGGTCTATCCTGACCTGGCCGAGCAGGAGAGCCTCTGCAACCCGGGAGGCGGGAGCATTGATTAGCTCACTAAACCCCCGCCCTCAGCCTACTTAAATTTAATTAAGCCATCGGCGCACGGTCTTTTATTAGCTCTAGTCAAAACTAAAGAGGGTTCGCTTTAGCCACACTGGGAGTGGATCACCCGTTCTCTACTAAAGTGTGCCGGGGGAGGAGCCTGTTATTT…

There are different methods to create the desired type of image. In Photoshop, one approach is to write the letter sequence as text attached to a marked-up line, which could be spiral in nature. Alternatively, a simple layer could be added to an antique family photograph. Another option is to use Processing to run a program that generates an image from the letter sequence, such as Text2Image.

The latter was implemented and is the more sophisticated visually. Text size and colour is varied to produce a form of typewriter art. Experimentation with parameters was clearly necessary from a previous implementation which was either too crowded with text or too sparse. I need to find the happy medium.

The more sophisticated approach for creating the image was through Processing’s Text2Image program, where the text size and color can be varied to produce typewriter art. However, experimentation with the parameters is necessary to find the right balance. In a previous implementation, the image was either too crowded or too sparse with text, so I need to find the sweet spot.

By combining computed visuals with my photography and incorporating animated teeth as a narrator albeit quite basic until further refined., I hope to create a unique and engaging experience for viewers that explores the topic of mitochondrial DNA in a new and exciting way.

The available mirrorless camera has a maximum resolution of 8192 x 5464 pixels, which translates to approximately 29 x 19 inches at 300 pixels per inch (ppi) when printed.

In 400 megapixel mode, the camera captures a series of images and then combines them into a single high-resolution image with a resolution of approximately 16,384 x 10,922 pixels.

Assuming a print resolution of 300 ppi, the largest physical print size possible from the camera in 400 megapixel mode would be approximately 55 x 36 inches. However, it’s important to note that the exact print size achievable may depend on factors such as the printing technology and viewing distance, and the final image may need to be downscaled or cropped for optimal quality.

Using Topaz Gigapixel AI the image height can be extended x6 to 330 inches which is now too tall for exhibiting. At a height of 1.85 metre / 55 inches the multiplier doesn’t need to be x6, Nearer 1.3 (1.324) would suffice especially when the print wouldn’t go to floor level.

Update on making immersive test prints on an Epson 180 / 360 ppi A2+ printer:

Assuming a print resolution of 300 ppi, the largest physical print size possible from a camera in 400 megapixel mode would be approximately 55 x 36 inches. However, to refine the size for an Epson printer that operates at 360 ppi, we need to adjust the calculations. If you’d like to print at a larger size without noticeable loss of quality, 180 ppi can be used.

First, let’s calculate the maximum print dimensions at 360 ppi: To calculate the dimensions, we need to know the pixel dimensions of the 400-megapixel image. Assuming a 4:3 aspect ratio, a 400-megapixel image would have dimensions of approximately 23200 x 17400 pixels.

At 360 ppi: Width: 23200 pixels / 360 ppi = 64.44 inches Height: 17400 pixels / 360 ppi = 48.33 inches

So, at 360 ppi, the largest print size would be approximately 64.44 x 48.33 inches.

Now, let’s calculate the maximum print dimensions at 180 ppi: Width: 23200 pixels / 180 ppi = 128.89 inches Height: 17400 pixels / 180 ppi = 96.67 inches

At 180 ppi, the largest print size would be approximately 128.89 x 96.67 inches.

However, the available printer can use roll paper but has a maximum width of 17 inches. To print the maximum size, you would need to print the image in strips that could be joined together side by side to achieve the maximum resulting print width required.

At 360 ppi, you would need to divide the width (64.44 inches) by the maximum printer width (17 inches): 64.44 inches / 17 inches = 3.79 strips (round up to 4 strips)

At 180 ppi, you would need to divide the width (128.89 inches) by the maximum printer width (17 inches): 128.89 inches / 17 inches = 7.58 strips (round up to 8 strips)

So, you could print the image in 4 strips at 360 ppi or 8 strips at 180 ppi and then join them together side by side to achieve the maximum resulting print width required.

The world of photography has come a long way since the inception of my photographic practice. From the traditional use of film to the advent of digital photography and mirrorless bodies, the technology has advanced by leaps and bounds. One such advancement that may revolutionise my stills based photography is the ability to capture high-resolution images. However, this was not the case in my practise until a recent development in mirrorless DSLR in body stabilisation IBIS introduced the capture of 400Mp images.

In the past, photographic image size was limited, and my preference was for low-resolution capture to enable smooth operation of my creative post processing workflow.

This was primarily due to the economic limitations of technology at the time. Affordable pro DSLR cameras were not capable of capturing high-resolution images. In the latest firmware release the mirrorless DSLR can. The cost of processing and printing high-resolution images was prohibitively expensive. The latter may still be the case except with a resolved body of work there is less risk of repeated iterations of the expensive process.

Despite the former limitations, I was able to create abstract works of art up to A4 size. I relied on my creativity and the ability to manipulate the image in post-processing to produce the results. In fact, like some other photographers we preferred the low-resolution capture as it allowed us to produce a more dream-like, painterly effect.

However, with the advent of digital technology, the limitations of photographic image size have been largely eliminated. High-resolution images, such as the 400Mp technology, became available in a recent firmware exploitation of IBIS control as mentioned.

When combined with tools such as Topaz Gigapixel, which uses AI to increase the resolution of images up to six times, the possibilities for creating large-scale prints should now be possible within my practise

This development has challenged an earlier decision to limit photographic image size. For example, in the past, A4 prints were considered large enough for most purposes. However, now the potential for creating extremely large prints is possible, with the ability to create prints the size of a house door. I will proceed to confirm the technical details allow this or at least find out the new maximum limits.

Some of my earlier work incorporated hand-drawn vector graphics which would scale if I reintroduced these ideas which I really enjoyed making.

The decision to revisit the intention from 2019 to produce work on the scale of Marc Rothko’s as immersive “Art as an Experience” now seems practical with the techniques now available here. The potential for creating large-scale prints that allow the viewer to stand close and experience the work on a visceral level is exciting. This is particularly true for photographic works that capture the beauty of the natural world of the human healing experience.

In conclusion, the advancement in photographic technology has challenged the traditional limitations of photographic image size. The potential for creating large-scale prints that allow the viewer to experience the work on a visceral level is exciting. The decision to revisit the original intention to produce work on the scale of Marc Rothko is a logical one, as it allows the creation of immersive art that can be experienced on a grand scale.

Hello there! I am excited to share with you that I am restarting work on the 3D model of my studio space for my Exhibition. As you may know, I created the 3D model as part of my Masters Final Major Project back in 2020. Since then, I have not had the chance to work on it, and my SketchUp skills have become quite rusty. Therefore, my main objective in revisiting the 3D model is to reacquaint myself with the SketchUp tool and improve my skills.

One of the tasks I need to do is to add my exhibition photographs to the pre-existing virtual display/exhibition frames. This will enable me to showcase my work and share it with others virtually. However, I need to find some learning resources to help me get back up to speed with SketchUp.

To this end, I have scoured the internet and found a range of useful resources, from YouTube videos to SketchUp courses. I thought I would share these resources with you so that you too can benefit from them.

Firstly, I found a series of SketchUp tutorials on YouTube at this link that are perfect for beginners. These tutorials cover everything from the basics of navigation to more advanced features such as 3D modeling and rendering. The tutorials are easy to follow, and the presenter explains things in a clear and concise manner.

Secondly, I discovered a range of SketchUp courses:

– SketchUp Campus

– SketchUp Fundamentals with set of Exercise files

These courses cover a range of topics, from the basics of SketchUp to more advanced features such as using plugins and extensions. What I like about these courses is that they are self-paced, so you can learn at your own speed.

Lastly, I came across the SketchUp website itself, which has a range of learning resources available. They offer a range of tutorials, videos, and webinars, covering everything from the basics to more advanced topics.

I am excited to dive back into SketchUp and improve my 3D modeling skills. I hope this post has been helpful in pointing you towards some useful resources for learning SketchUp. Whether you are a beginner or an experienced user, there is always something new to learn. Happy modelling!

This item has been moved to the Contextualisation blog

Apologies for that. I’m trying to instil a greater degree of order and finding it quite a challenge as (with any filing system, and this blog is a document filing system) one item might store in two locations. Ultimately it is better if readers can find stuff.

This has happened following discussion amongst fellow students at the new session Module Leader Group Tutorial. Having said that we have three Alumni visiting next week to talk and specifically mention about organisation

We’ve entered a busy time with several work items in progress.

Portfolio

http://bit.ly/2QojUIa

A portfolio of images has been submitted. The challenge this time has been to create a consistent look to the set. The portfolio has dropped close-up photographs this time and only abstract images are present. This gives greater consistency as does adopting a square format throughout.  

Abstract presents a challenge in maintaining narrative. The way I’ve gone about tackling this is to display on a single line. This way control is maintained of viewing sequence where a grouping would allow a potentially clash.

What I decided was to place images inline in groups of three with a blank tile punctuating the sequence. This gives scope to introduce a rhythm as in a poem or song.

The next decision was to use captions and I decided on a call and response method which with some repetition adds to the narrative. When assembling my work I decided also to read the captions and record as an audio track added to a screen version of the images. This proved quite powerful and attracted someones attention.  attention of  is something I’d like to explore as an installation.

As the abstracts are predominantly red, when printed I was able to tune the room lighting and in doing so noted a dynamic was introduced, a perceived movement within the images. This is something I’d take further with an installation and I’ve not discovered the impact without doing my own printing (calibration required control of the lighting).

Oral Presentation

http://bit.ly/2QojUIa

Over the summer an unplanned change of platform took place and so a new set of tools were adopted for this production task. Regardless of the software being much easier to use, it is still distracting learning new controls whilst constructing a new workflow. Nevertheless is was a surprisingly enjoyable experience and apart from a few stumbles over my words during recording the process went relatively smoothly. 

A benefit of the MA Photography course in having these assignments is that time is available to consider and review the content and this enhances motivation. As usual it is difficult to get it spot on throughout this process. I detect other students have similar experiences. As the deadline approaches, it is towards the end that I find I force the issue and make a late breakthrough.

My thinking had been challenged throughout as I needed to simplify. There were several strands running together that ranged in degree of difficulty to resolve and present. It is necessary to communicate at the level an audience will engage with. The breakthrough emerged and yet I was rather nervous of falling into a trap – sometimes authors wax lyrical about their work in ways that just don’t match up to the reality.

So with trepidation, I began to unwrap the whole thing and got it down to a base level I’d hope others could engage with. The motivation for my work is expressed more clearly as a transformation of childhood experiences of family culture into a more rounded adult view. When those around me engaged me in conversation as a child, I understood as a child. As an adult I can recognise the gaps and begin to use existing knowledge to expand out into the gaps. As an adult, I can also begin to create visual references that help complete my understanding of their experiences including loss unspoken.

In the process I took onboard the comments received in review. I’d like the work to be perfect but realise I’m learning and hopefully improving the strength of the portfolio work in each module. 

One thing I’m happily surprised about is the consistency of the subject. I could so easily have wavered onto some other branch of work. However, I still feel it is my destiny somehow to complete the work and so that has eased the decision making. Support from a wider family has been immense as they connect emotionally with the work and love to see the images I made and now make. In this respect the work is gaining traction with requests starting to come in from them for selected copies of the work. Although I cannot charge them for the work, I asked one to give to charity a small amount for each print they make.

Printing – is so important

Printing loomed large as a big thing. I was printing successfully before the summer but it all fell away with that change of platform. Software compatibility issues and default installations had held me back even after attempting to calibrate end to end. I took out the weekend before last to investigate what was behind such dark colour prints and I resolved it on my own. It was a manufacturer caused problem but with dogged determination it was solved. Now the abstract pictures that glow on screen print in entirely the same way on paper! I’m really pleased with the results and totlly enjoy getting back to tangible manifestations of my work.

Tutor advice to a student was taken onboard. I can now handle, order and re-order the prints, write on the backs, and basically enjoy them. I feel that print and more to the point, control over the print workflow will become increasingly important as the MA Photography course progresses. I kind of knew that but it is exciting to get back on the printing track. Watch this space.

module constraints

My best work, continues to fall down the gaps, as the flashes of creativity experienced  have so far occurred in a natural order, in very close proximity to module start dates but not close enough to qualify for publication. As a continued source of frustration, I’ve tried to slow down in order to coordinate with study module dates.  Potentially, what has happened is that inspiration is drawn from within, without necessarily referencing the Module content, simply due to circumstance

scope

Having got the above out into the open, let me turn to two areas a) the continuing development of practice in Abstract Impressionism, and b) the following up of advice to simply continue shooting, following one’s intuition.

 abstract impressionism

 stage I art

This is the area in which I originally linked  the beauty of the bodily healing processes to soldiers from family who were wounded, and repaired and who repeatedly continued on into battle in the Great War.

Let me see if I can illustrate developments. Originally I’d concentrated on impressions from the battlefield alongside the soldiers perspective on memories of home.  My initial technique  was Conceptual in using relevant images of colour and texture that in my artistic judgement provided scope for post processing into the abstract. I preferred techniques including pixel stretching. Both vertical direction, representational of  the environmental conditions and horizontal, representational of landscape. Then combined there is a layered  intent similar in form to  patterning found in Scottish tartan that might be missed by the viewer but conveniently supports the underlying Scottish theme.

This is just a base level of processing into image layers. These are then recombined with the original image in which line edge effects are enhanced. As required,  layers are hand-painted using masks. The effect I obtained at first I found to be visually stunning. Through planned shooting I had a wealth of relevant images within  my personal catalogue. Overshooting proved necessary as the success rate can be low as not all source images provide enough inspiration for abstraction.

This was the first area of creativity excluded by the course, however the technique was well practised and is available to reuse,. Having said that it does take time to read the base image and  in the application of skill when applying post techniques.  Often, and in favour of the work the techniques are not wholly repeatable. If I worked the same image again the outcome would be different. I like that in this digital age. Although not a deliberate act of destructive editing, practically to resolve this it might take a video recording of the creation process to accurately capture the steps.

 stage II art

This is the next development in abstraction and by chance I discovered that  post-processing colour beta value and applying simplification recreated an effect I’d long ago practised and had enjoyed. As I photograph minor trauma  in relation to mitochondrial DNA as the cellular powerhouse and generational link and do so in terms of  the beauty of bodily healing, I find this technique can work really well in bringing out a healing glow alongside a feeling of layering and looking into the image. I like this direction a lot. One or two images have immediately given this result. As experimentation continued other trauma made for highly saturated representations of colours.  An outcome obtained here is in drawing out areas of interest that the eye alone would miss. The camera records  surface features and layers in post that we  do not ordinarily see. Again there is the same channelling of post processing towards destructive editing.

Two more steps to go. The first  relates to potential garishness in colour saturation which is not readily eliminated. A jury is out for me on this  but I may use this as a signature theme. Otherwise I should experiment in further degrees of subtleness.  In this sense the image continues as a crafted piece of work, which I think adds to its value.

The second step, is possibly fairly intuitive which is to cross, that is combine, stage I and stage II art. In fact this has now been tried, and I like the outcome as it does tone down colour saturation which can overwhelm the senses. In retrospect that could be quite representational of any hurt suffered. The crossing does gives the mellowing effect and refinement I thought I was looking for. Either way there is no loss from learning how to control an image.

technique

There are challenges when photographing even minor trauma not least in my project, is getting relatives onside. As photographer I’m more acutely aware of those minor accidents to self as they can hurt. Now instead of saying ouch and moving on, I immediately go for the camera and as a person my reaction has already been conditioned to this.  The challenge is in photographing when position may be difficult to deal with. There are circumstances where a smartphone camera is ideal yet pixel resolution might show. Turning to macro techniques increases the challenges already faced as equipment becomes cumbersome and unwieldy in the circumstances.  Problem solving though is a key part of photography to be enjoyed, isn’t it?

image audit

Not mentioned thus far, I feel I need to instigate a method of auditing from original file through to abstract. Earlier techniques were non destructive and most of the working could be preserved in saved layers but no longer is this the case. I do need an audit method even if only for my own sanity if publishing later on.

developments in ongoing shooting – the intuitive  part

This topic runs parallel to my project and welcomed as it gives another  frame of comparative reference compared to abstracting images of trauma.

This also hopefully demonstrate I’m active in photography in other ways throughout the current module.

lending support

I had an interlude photographing trees or large shrubs where gravity was getting the better of them, where the intervention of a gardener meant metal supports were provided. I found a temple garden where this was common.  The plants flourished as nature adapted to the support provided. An initial motivation in shooting was around interesting triangular composition. This  evolved to observations of how successful the ways are in which the support was provided. Then I tried to liken this to the support society gives to those in need. Thus a parallel is opened on social or political comment.

The photographs were first pass and as the lighting was strong and contrasty. I would need to return with cloudier skies with more even lighting to obtain the desired exposure.

 national charity engagement

This is an area I previously mentioned in a tutor group and which was viewed as a  good thing in providing a backup project if the current work cannot proceed for one reason or another. It was also advised I be wary of being used as a photographer to the  charities own ends.

Preliminary test shots were made and I was due to go back when the time was right – here note earlier comment about progressing a little too soon.  Meanwhile though, I managed to have a long discussion with one of the volunteers who was very helpful. I’d talked in terms of  continued interest. and during our discussion various narratives unfolded although at least one I’m sure I’d seen in their publicity somewhere.  I gained a broader understanding of how I might embed. without causing interference to the working processes. No further photographs this stage.

Aid to Understanding Genetic Relations:

Genetics can be a very complex area to grasp. In light of this difficulty, I reference a BBC documentary on the subject.
I watched it several times over a few years back. In video form it provides an explanation of genetics in action as a body under constant invasion, acting in defence and under repair.

www.dailymotion.com/video/x4fjy56

Here also for anyone interested is Wolfram Alpha (a web page – there is also an app) showing how to calculate genetic relationships in this example for my:

great granduncle genetic relation

Click the link, wait for the computation and click more for genetic detail. This has examples and you are invited if you wish to select other relations and compute these.

Original post: